Genetic studies of a cluster of acute lymphoblastic leukemia cases in Churchill County, Nevada.(Mini-Monogragp)
RESULTS: One bilalleleic gene locus in SUOX was significantly associated with either case or comparison status, depending on which alleles the child carried (without adjusting for multiple comparisons).
CONCLUSIONS: Although genetic studies did not provide evidence that a common agent or genetic susceptibility factor caused the leukemias, the association between a SUOX gene locus and disease status in the presence of high tungsten and arsenic levels warrants further investigation.
RELEVANCE: Although analyses of community clusters of cancer have rarely identified causes, these findings have generated hypotheses to be tested in subsequent studies.
The polymorphisms and their dbSNP (Single Nucleotide Polymorphism database; http://www.ncbi.nlm.nih.gov/SNP/) identifier, if available, are listed below. Polymorphisms in TYMS 28-bp tandem repeat and TPMT variants 460G[right arrow]A (rs1800460) and 719A[right arrow]G (rs28933403) were genotyped as described by Relling et al. (2004). We genotyped SLC19A1 80A[right arrow]G polymorphism (rs1051266) by direct sequencing, using primers AGTGTCAC CTTCGTCCCCTC (forward and sequencing) and CTCCCGCGTGAAGTTCTT (reverse). We genotyped the SHMT1 1420C[right arrow]T polymorphism (rs1979277) by a modification of a Taqman assay (http://snp500cancer.nci.nih.gov; SNP500 assay number 003_1859), using amplification primers ATTTGTGAAGAAAACATGAA AAA (forward) and AGACTGGCAGGG GATAAGTA (reverse). The GSTP1 313A[right arrow]G (rs1695), NQO1 609C[right arrow]T (rs1800566), MBL2 codon 54A[right arrow]G (rs1800450), ABCB1 3435C[right arrow]T (rs1045642), MTHFR 677C[right arrow]T (rs1801133), and VDR start codon FokI polymorphism (rs2228570) were genotyped by DNAPrint Genomics (Sarasota, FL) in a multiplex PCR followed by single base extension.