Register for free to join our community of investors and share your ideas. You will also get access to streaming quotes, interactive charts, trades, portfolio, live options flow and more tools.
Register for free to join our community of investors and share your ideas. You will also get access to streaming quotes, interactive charts, trades, portfolio, live options flow and more tools.
Aaaand the NASDAQ has started Delisting Procedure. This was a ELDORADO OF SHORTS, I have never seen so big money loses as management did, for example $700 milion in 2023Q1, the smashing of cash in 2022, prudent defraudants and this CEO in Natura, unprecedent!
I remember in Feb. 2022 was SP $940 and in January 2023 $125 per share. So the Footprints in Dogshit never make You lucky!
See you later at OTC afterlife.
Do you think man the MULN can touch a like LKNCY Elysium??
Hello David!
On Wallstreet are going the stories for example: "Mitchery-Fu**ery", "Mitchery-Bitchery" and so on. This Bazoum like businesses 95% of dollars from Uranium and Uranium total for French and 5% for Niger you can´t try on me! Your 95% short accounts pregnant called as "buyback" and 5% to shareholders, its Unicum!
Some predictions: "I just met the Fiftycent, he maybe concert in Prague. He said: " I´m not so rich to buy MULN for a dime!"
Silvester Stallone: " The lead ball is too expensive for him, I finish this job with a knife. The Stings have to be so Sharp as unmet promises, fair value One Sting for one Reverse Split and knockouts cumulated as he decimated the Original IPO shares of shareholders! Thanks to John Gotti jr.!
David, man!
I knew Your proposals prepared to annular shareholders meeting at 3 August, I considered it as a joke , but in the run of Time your horrible musk was demusked as well.
David, what do you think you are, what about "fuc.." proposal up to 1-100 reverse split? Are you a Thieve to escape to Maryland?
NO, David, do not play with me, especially not the lower balls!
I became highly upset and blood is boiling in my body. I ordered to my institutions withdraw any financial support and additional funding to MULN and to my filiales so until you fulfil my conditions.
At now you are blacklisted in World investment companies!
David Mitchery you need to put knife on your deck as a motivation, Investorsplace is laughing into face of people, please tell everybody they are wrong!
David recall the Dilutive Proposals and Escape to Maryland, show me the "around the corner" production, delivery in August as you mentioned before, give me a proof of production 15950 EV´s in 2023 or its nothing to mention.
Be successful without reverse splits and dilutions or die!
David show that you are the truly man making and finishing the good things, show me the "around the corner" production in July & recall the proposals and Escape in Maryland so we can renew the Proper Business Relations, otherwise I´m forced to make additional measurements.
Dear David Mitchery!
You don´t know, how to fight the shorts? Another robbery to 10 Uscents?
Wake up Buddy! Give them no chance to manipulate, show the production, mark the start "is around the corner", lift the price up to $1,40 in first run, the shorts can´t survive, they will die on lack of oxygen in margincalls Hell.
Show me the money and satisfy investment into, otherwise you make the Missmatch and play doubtful chessgame which can end by your another Game over.
Show them at once You can be succesfull and bring the things in good finish without another reverse split and dilution!
David Mitchery is not predicted to fail! The Shortsgang around the main official basher at Investorplace.com is hardly into, but no time to smuggle, time for them exists never more.
In the near therm the pruduction is allready starting and 15965 EV´s would be sold in 2023 with median price $100.000 makes together $1,5965 billion.
How is the pricing look like? By conservative 30x P/E its $48 billion market capitalisation, SP around about $80 per share with OS 600 million.
This possibility draws near the rich Sheyk to invest, maybe $10 billion installment, 20 years / $500 million per year, who knows?
Bye-bye shorts, I'm the Last Shadow!
Your's Toruk Makto.
RenovoXT has avery promising and positive breaktrough technology outputs from PHASE III, +5% hahaha, its joke hahaha!
I´m buying it all the Time and will sell minimal for 7,50 USD per share or by $10 for buyout, acquisition! Thank you sellers, for nothing. Whahaha!
In facts that WHO called The New Event, RSV will kill in all World, especially in UK, massive in the time of Autumn to Spring the children up to 2 years and all adults (not old only) with "Long Covid" from vaccination and vaccinated adults with broken immunity. The move of LMDX is very prophylactic and may earn to them from 500 million to 1 billion USD clear profit after taxes.
Mark my words! Tests will be needed in billion!
Dear Chen, CEO of Faraday Future,
there is no reason to make reverse split too early and kill momentum except you assassinated the Company for your private profit. Chen be smart and wise, your PR can cause 500 millions sell volume with difference maximal 17 cents down with price, it makes for your short positions gain USD 85 million only, but if you terminate the proposal the growth about plus 1 USD brings in your pocket 500 million USD, another 1 USD by price 2,48 USD per share or from 1.28 to 2.28 USD another plus 500 million USD to your account. I think its enough to bail out your friend with 2,4 billion Remhinbi blocked in China.
Otherwise i have to in the name of Chinese Heritage, in the name of Confucius, hammer out you and Chinese from USA and return you into your homeland with biggest blame of the World. No american investment in China will follow!
Dear Xuefeng Chen, CEO of Faraday Future,
how do you find out to kill the share price momentum "HONEY", and why this silly and desperate move after market closing? No letter from Nasdaq was send to you, nobody has pressed you to make "SEPPUKU" and put the knife into the neck of shareholders. On October 2023 is daedline, not the 16.6.2023, terminate this proposal quickly or I will terminate the FFIE (FFAI) and smash this scamride from the US market. I invested maybe millions into FFIE, but with the billions I force it to short to ground zero, I swear, I´ll make it happen! This fishy chinese money outburst and chinese practising will be in the USA no more. Do you shorting your own firm Chen?
Terminate this proposal Chen or I hammer out you and Chinese from the market forever.
It could in 7 trading days reach 1.65 USD per share and get all Nasdaq rules just without your PR.
Dear Dennis,
Frank is kinda reason to buy and lock DPLS shares, he appears to be a biggest threat to your plan himself! The life is cat, not a dog waiting for Orders, as a Rothschild and Khazarians want to us, life is cat-independent, doing hers own job and if you will make her Angry, she will cut You!
Despite your visits of Energy Department, you will not became Rothschild, Vanderbildt, likely not a leader of mankind. "You will own nothing and you will be happy, you die and will be lucky!" Schwab,WEF, Bilderberg, Scull and Bones, Comitte of 300, Triglav, Free Masons, Jezuites, Templares, Khazarians, Asyrians, Babylonians are all the bloodline of Kain and Kain has killed the Abel before 5550 years.
Despite recent Enslavering, mankind refuses to accept the Vision of Extinction, to be replaced by AI, brain chips, to consume 60 GHz a 5G and 6G Kalium Cyanide, food, watter, air poisoning and other tools of Slavery and Holocaust.
I have 7 billion reasons to not buy your shares without using of FUD "shitmill" of shorts. You have made "a Zilla servis" to shareholders forcing it to fall from 20 cents to double zero, the "Zilla nation" can´t remember, but I do!
Do you know the film "the GOD forgives, I dont!" ?
So at the end must be the question answered: "Was pleasure of the flight from 0.0001 at November 2020 to 0.20 USD at July 2021 equal to pain of crater from 0.20 USD to 0.0030, at July 2021 to May 2023 ??"
No brainer, the story of former NYPD and DEA officer which became a businessman, when retires, is fascinated. May be called "My 7 billion OS business with shareholders" or "how I superdiluted into NASDAQ", promised dividend was never in play. On other side the project was not publicly supported, "take the Money where they are ", so a bit chinese nature, what Dennis M´OLeary did.
I never trusted you Dennis, i loved this short-pump vehicle, last 2 years forced in the only "one way".
What about recent gain? How is it to be dancing on the highs?
Historically has never RSI overcrossed 90 points, people , "be familiar with the matter", no 0.02 USD, no, yet descending Hawk to 0.0090 on to support and at last the little finger up to 0.015 USD! No more if will be SPAC with business combination listing on Nasdaq succesful, if not the another fall to 0.0001!
I found Dixon very interesting Guy. He told to me MULN becomes the GM in EV, with his experiences and production of 6 millions of cars in GM I trusted him. So I´m getting my cup of Luckin Coffee, which I bought at 0.98 and was tempted to sell at $15 but sold at $24, as a MULN in EV industry. My $100 millions bet is set, NO JOKE!
Aladdin with you!
This are not sentiments, this are Facts. The world of Big Money, where I´m coming from, is not sentimental, it is the World of Facts and a knowledge is making the money, You know.
Joseph Sandberg is maybe prepared to kill his baby, which Apron really is, live with the shame, but I´m not!
He maybe want to make a shot in his head and rotate the Colt in Russian Roulette, but I´m standing nearby and I will drain him up to last my penny invested into!
The new strategy needs the Time to work out, the sales are growing yet something about 5%!
World is changing so much as the Globalist´s wrongdoing is getting stronger, AGENDA 2030 on the Table means only: "We can find hear the Time of Epidemie (Pandemie) and the Time Between", people in death panic will lock themselves and the Apron will be beneficiary again.
Dear Atlanta1, the 80% killer, the artificially made virus Sars with very agressive Spike Protein produced by USA and Chinese scientists, is about to Escape from Laboratories, Fauci-Faust is the Chief of Project and with Bill Gates biggest donor. Bill Gates never gives up the Plan to "reduce the number of humans to 500 million".
Fort Detrick, dear Atlanta1, has hidden and dangerous secrets rather to know nothing as it!
After 5G communication system with 60 GHz frequency was publicly proven by WUHAN EXPERIMENT last 2019 and early 2020 to be a Lethal Weapon (1,2 million Chinese died by lack of oxygen), 60 GHz is absorbtion frequency of oxygen, with similar effect of consumation of KaliumCyanide- KCN, was "succesfully tested" in many Lands and States of the Earth, lastly twice in Czech Republic by Police Academy to bring students into Coma and in Prague by Public School (state school) with similar damages, the Direction is clear Sir.
Its Time to do something against this or be killed by Globalists, Alex Soros, "ein Scrupullose Mann mit kategorischen Imperativ, er kann befehlen und der Welt ordnen", for example he commands the Austrian Chancellor to vaccinate all inhabitants, will be named the King of the World by SION Protocolars. What are You choosing now?/b]
If Joseph Sandberg misled the Investors and Shareholders, than lawsuits , FINRA and SEC will follow him up to death.
Every delay in fulfilling of promises weakens his reputation, if delay persists too long - more as one week, Sandberg will be almost finished! His disability to hold the word, hunting in darkwater to buy the Apron shares at cheapest, dirty game, can´t the Market accept.
"Hello, Joseph Sandberg, how is it to be a Business Renegade, Misleader and Involved Scammer???"
This welcome can be the Nightmare only!
Mullen at this Price per Share is considered done by bankruptcy and kissed by Wallstreet death, but isn´t right this?
1, has Mullen original breaktrough technology of battery for EV´s with production capacity 30 000 pieces per year, or not?
2, has Bollinger B2 military contracts, or not?
3, Is Mullen´s EV champion in the World or not? Can somebody in the World competite this trucks and vehicles?
I see the bright future and shorts battered and suffered big loss, dilution can be interrupted everytime and financial help to come in time around the corner, surprising can become ideal storm!
Enjoy the next ride please, the train never wait for undecided, FOMO is coming forever late!
It still the way on the Table, how to punish the old known FDA mafia, break them down.
RVVTF Agenda
1, Make the RVVTF stock worldwide known as a producer of Bucillamine, the best drug against Covid without side effects
2, Draw near the Investors, what want to burn shorts, make this a MEME Stock !!
3, Draw near the all small investors, which want to know the Truth and dislike to be death by vaccination and other experiments
4, Destroy with the Outnumbering all Wallstreet parasites, burn these Hedge Funds and known Manipulators
5, Make this stock untouchable for Shorts with long and unexpected grows in PPS
If you want to bring the value to Shareholders, first step is:
To REDUCE THE EXCESSIVE number of outstanding shares from 5,4 billion unrestricted to 1 billion
To REDUCE THE EXCESSIVE number of authorized shares from 20 billion to 2 billion
in agreement that You are taking the business seriously
Hello, Mr. Frank! Will it be a neverending bad turkish Telenovel or like Scott Mahoney "Turkish Comedy" ??? Can you answer yet, please, not "next Quarter" ?!? (the obvious and permanent phraseology of RVVTF CEO)
Pilling the Omicron is rather very good and imposant job of massmedias. Scary them, embarrass, depress and supress them by CovidFire, an illness killing 0.005% of humans. That virus is not daedly as Gates and Globalists want, make him Great Again with Jab, Vaccination and Mandatory Death. Look at Austria, an Nazi dictature like a Australia, Mandatory Death is a way, how to Statedelinquents pay to "borrower" Rothschild and Rockefeller.
I remember, that last news and PR from Taronis was: "The ceremonial of accepting MagnegasFuel and show of plasma cutting in Turkey takes place at 5-th.July 2020 in presence Minister of Industry, so the additional contract in $150 000 000 imagines 50 Magnegas units up to 350 units in Turkey-TRNF venture..!" blah-blah-blah, thank you much master Scotty alias Frank!
" Wochebericht des Robert Koch Institutes 30.12.2021 " Im neuen #RKI-Wochenbericht fehlt die übliche tabellarische Übersicht zur Impfeffektivität. Dafür gibt es die folgenden Impfstatus-Infos zu 4206 von insgesamt #Omikron-Fällen:
Weekly report of RKI Germany :
https://www.rki.de/DE/Content/InfAZ/N/Neuartiges_Coronavirus/Situationsberichte/Wochenbericht/Wochenbericht_2021-12-30.pdf?__blob=publicationFile
- 4020, ergo 95,58 % vollständig Geimpfte (1137 davon geboostert)
- 186 Ungeimpfte (4,42 %) @welt
https://twitter.com/hashtag/RKI?src=hashtag_click
" Tim Röhn
@Tim_Roehn
Im neuen #RKI-Wochenbericht fehlt die übliche tabellarische Übersicht zur Impfeffektivität. Dafür gibt es die folgenden Impfstatus-Infos zu 4206 von insgesamt #Omikron-Fällen:
- 4020, ergo 95,58 % vollständig Geimpfte (1137 davon geboostert)
- 186 Ungeimpfte (4,42 %)
Pierre L. Gosselin
@NoTricksZone
·
Dec 30, 2021
NEGATIVE EFFECTIVENESS? h/t: @ninimuckeline
The usual tabular overview is missing in the new #RKI weekly report. Too embarrassing, maybe?
For 4206 total of #Omikron cases:
- 4020 (95.58%) COMPLETELY VAXXED (1137 boosted)
- 186 (4.42%) UNVAXXED
Quote Tweet
Tim Röhn
@Tim_Roehn
· Dec 30, 2021
Im neuen #RKI-Wochenbericht fehlt die übliche tabellarische Übersicht zur Impfeffektivität. Dafür gibt es die folgenden Impfstatus-Infos zu 4206 von insgesamt #Omikron-Fällen:
- 4020, ergo 95,58 % vollständig Geimpfte (1137 davon geboostert)
- 186 Ungeimpfte (4,42 %) "
In Israel 45% total unvaccinated people, 55% not completely finished status, 10% of children vaccinated - total failure of Holocaust, 15% boostered with 4-th."shot". 5896 top Sporters of the World died on vaccination between 1-7 days after "shot", 389 documented cases of death in worldwide Press. Fast 100 000 other professional sportsman, male and female, include young children not mentioned.
In Rusland 35% vaccinated, 65% unvaccinated, the QR code Gates dictature terminated at 18-th. December 2021 as soon as 100% people did not shopping in Markets.
Demostrations over all Rusland, Europe, Africa and rests of the world. The Doctors are rising against Gates and GAVI Genocide everywhere, "Green passes" - the Covid Segregation Hell will be hold down soon.
Hold firmly! What inventor of PCR test Dr. Kary Mullis knew if he had to be killed? Answer https://www.globalresearch.ca/bombshell-cdc-no-longer-recognizes-the-pcr-test-as-a-valid-method-for-detecting-confirmed-covid-19-cases/5765179 you can download it in PDF too. Not comfortable for Gates COVID pandemy and profit.
Second, why I´m even more encouraged (based on last RVVTF PR) to think the "MR. Frank" is reincarnated "fat Scott Mahoney" from Taronis ???
You dont know really what´s a go! Remember Dr. Nauck (Graphen in vaccines), 100+ killed biologist researching Nagalasa, why this slow down? THE TRAIN IS NEARLY GONE ! INVENTOR OF PCR TEST found death in the car after he declared to PUNISH FAUCI "THIS SMALL DEVIL" BY THE COURT etc, etc. Breakthrough technologies likely to be missmatched, stolen and hidden in bunkers of CHAZAR Rothschild-Rockefeller Askenazy company. FED and Central Banks as a filiales and pharmaceutical petrodollar in hand to hand by Wars, whats is necessary for you to explain? THEY ARE VERY AFRAID FROM PERSONAL INICIATIVE, THEY ARE SCARED FROM INDEPENDENT AND FREE PEOPLES WHICH CAN OVERTHROW THEIR IMPERIUM IN THE DUST!
It stinks like a Taronis Fuels deal in Turkey!!!
Hello mr. Frank! What are you DOING NOW???
Every term is broken, no product, no EUA, NO APPROVAL for Bucillamine fast 2 years!! If you will be not killed by a Big Pharma, sure on 100% killed from RVVTF SHAREHOLDERS.
"We signed big deal for billions pills with Terra Pharma.".. blah-blah-blah. " We are getting approval from FDA soon on the July 2021, wait December 2021, wait on Omicron "....blah-blah-blah. We anticipated to fill in outputs from Study at November, wait December 2021..".blah-blah-blah.
ARE YOU KIDDING ME???
Shocking Research what mRNA SpikeProtein inflicts to your body, DNA, NHEJ reparation and "oldering":
" MDPI - Viruses
https://www.mdpi.com/1999-4915/13/10/2056/htm
https://www.naturalnews.com/files/viruses-13-02056-v2.pdf
Open AccessArticle
SARS–CoV–2 Spike Impairs DNA Damage Repair and Inhibits V(D)J Recombination In Vitro
by Hui Jiang
1,2,* and Ya-Fang Mei
2,*
1
Department of Molecular Biosciences, The Wenner–Gren Institute, Stockholm University, SE-10691 Stockholm, Sweden
2
Department of Clinical Microbiology, Virology, Umea University, SE-90185 Umea, Sweden
*
Authors to whom correspondence should be addressed.
Academic Editor: Oliver Schildgen
Viruses 2021, 13(10), 2056; https://doi.org/10.3390/v13102056
Received: 20 August 2021 / Revised: 8 September 2021 / Accepted: 8 October 2021 / Published: 13 October 2021
This article belongs to the Special Issue SARS-CoV-2 Host Cell Interactions
Abstract
Severe acute respiratory syndrome coronavirus 2 (SARS–CoV–2) has led to the coronavirus disease 2019 (COVID–19) pandemic, severely affecting public health and the global economy. Adaptive immunity plays a crucial role in fighting against SARS–CoV–2 infection and directly influences the clinical outcomes of patients. Clinical studies have indicated that patients with severe COVID–19 exhibit delayed and weak adaptive immune responses; however, the mechanism by which SARS–CoV–2 impedes adaptive immunity remains unclear. Here, by using an in vitro cell line, we report that the SARS–CoV–2 spike protein significantly inhibits DNA damage repair, which is required for effective V(D)J recombination in adaptive immunity. Mechanistically, we found that the spike protein localizes in the nucleus and inhibits DNA damage repair by impeding key DNA repair protein BRCA1 and 53BP1 recruitment to the damage site. Our findings reveal a potential molecular mechanism by which the spike protein might impede adaptive immunity and underscore the potential side effects of full-length spike-based vaccines.
Keywords: SARS–CoV–2; spike; DNA damage repair; V(D)J recombination; vaccine
1. Introduction
Severe acute respiratory syndrome coronavirus 2 (SARS–CoV–2) is responsible for the ongoing coronavirus disease 2019 (COVID–19) pandemic that has resulted in more than 2.3 million deaths. SARS–CoV–2 is an enveloped single positive–sense RNA virus that consists of structural and non–structural proteins [1]. After infection, these viral proteins hijack and dysregulate the host cellular machinery to replicate, assemble, and spread progeny viruses [2]. Recent clinical studies have shown that SARS–CoV–2 infection extraordinarily affects lymphocyte number and function [3,4,5,6]. Compared with mild and moderate survivors, patients with severe COVID–19 manifest a significantly lower number of total T cells, helper T cells, and suppressor T cells [3,4]. Additionally, COVID–19 delays IgG and IgM levels after symptom onset [5,6]. Collectively, these clinical observations suggest that SARS–CoV–2 affects the adaptive immune system. However, the mechanism by which SARS–CoV–2 suppresses adaptive immunity remains unclear.
As two critical host surveillance systems, the immune and DNA repair systems are the primary systems that higher organisms rely on for defense against diverse threats and tissue homeostasis. Emerging evidence indicates that these two systems are interdependent, especially during lymphocyte development and maturation [7]. As one of the major double-strand DNA break (DSB) repair pathways, non-homologous end joining (NHEJ) repair plays a critical role in lymphocyte–specific recombination–activating gene endonuclease (RAG) –mediated V(D)J recombination, which results in a highly diverse repertoire of antibodies in B cell and T cell receptors (TCRs) in T cells [8]. For example, loss of function of key DNA repair proteins such as ATM, DNA–PKcs, 53BP1, et al., leads to defects in the NHEJ repair which inhibit the production of functional B and T cells, leading to immunodeficiency [7,9,10,11]. In contrast, viral infection usually induces DNA damage via different mechanisms, such as inducing reactive oxygen species (ROS) production and host cell replication stress [12,13,14]. If DNA damage cannot be properly repaired, it will contribute to the amplification of viral infection-induced pathology. Therefore, we aimed to investigate whether SARS–CoV–2 proteins hijack the DNA damage repair system, thereby affecting adaptive immunity in vitro.
2. Materials and Methods
2.1. Antibodies and Reagents
DAPI (Cat #MBD0015), doxorubicin (Cat #D1515), H2O2 (Cat #H1009), and ß-tubulin antibodies (Cat #T4026) were purchased from Sigma-Aldrich. Antibodies against His tag (Cat #12698), H2A (Cat #12349), H2A.X (Cat #7631), ?–H2A.X (Cat #2577), Ku80 (Cat # 2753), and Rad51(Cat #8875) were purchased from Cell Signaling Technology (Danvers, MA, USA). 53BP1(Cat #NB100-304) and RNF168 (Cat #H00165918–M01) antibodies were obtained from Novus Biologicals (Novus Biologicals, Littleton, CO, USA). Lamin B (Cat #sc–374015), ATM (Cat #sc–135663), DNA–PK (Cat #sc–5282), and BRCA1(Cat #sc–28383) antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). XRCC4 (Cat #PA5–82264) antibody was purchased from Thermo Fisher Scientific (Waltham, MA, USA).
2.2. Plasmids
pHPRT–DRGFP and pCBASceI were kindly gifted by Maria Jasin (Addgene plasmids #26476 and #26477) [15]. pimEJ5GFP was a gift from Jeremy Stark (Addgene plasmid #44026) [16]. The NSP1, NSP9, NSP13, NSP14, NSP16, spike, and nucleocapsid proteins were first synthesized with codon optimization and then cloned into a mammalian expression vector pUC57 with a C–terminal 6xHis tag. A 12–spacer RSS–GFP inverted complementary sequence–a 23–spacer RSS was synthesized for the V(D)J reporter vector. Then, the sequence was cloned into the pBabe–IRES–mRFP vector to generate the pBabe–12RSS–GFPi–23RSS–IRES–mRFP reporter vector. 12–spacer RSS sequence: 5'–CACAGTGCTACAGACTGGAACAAAAACC–3'. 23–spacer RSS sequence: 5'–CACAGTGGTAGTACTCCACTGTCTGGCTGTACAAAAACC–3'. RAG1 and RAG2 expression constructs were generously gifted by Martin Gellert (Addgene plasmid #13328 and #13329) [17].
2.3. Cells and Cell Culture
HEK293T and HEK293 cells obtained from the American Type Culture Collection (ATCC) were cultured under 5% CO2 at 37 °C in Dulbecco’s modified Eagle’s medium (DMEM, high glucose, GlutaMAX) (Life Technologies, Carlsbad, CA, USA) containing 10% (v/v) fetal calf serum (FCS, Gibco), 1% (v/v) penicillin (100 IU/mL), and streptomycin (100?µg/mL). HEK293T–DR–GFP and HEK293T–EJ5–GFP reporter cells were generated as previously described and cultured under 5% CO2 at 37 °C in the above-mentioned culture medium.
2.4. HR and NHEJ Reporter Assays
HR and NHEJ repair in HEK293T cells were measured as described previously using DR–GFP and EJ5–GFP stable cells. Briefly, 0.5 × 106 HEK293T stable reporter cells were seeded in 6–well plates and transfected with 2 µg I–SceI expression plasmid (pCBASceI) together with SARS–CoV–2 proteins expression plasmids. Forty–eight hours post–transfection and aspirin treatment, cells were harvested and analyzed by flow cytometry analysis for GFP expression. The means were obtained from three independent experiments.
2.5. Cellular Fractionation and Immunoblotting
For the cellular fraction assay, the Subcellular Protein Fractionation Kit (Thermo Fisher) was used according to the manufacturer’s instructions. Protein lysates were quantified using the BCA reagent (Thermo Fisher Scientific, Rockford, IL, USA). Proteins were resolved by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE), transferred to nitrocellulose membranes (Amersham protran, 0.45 µm NC), and immunoblotted with specific primary antibodies followed by HRP–conjugated secondary antibodies. Protein bands were detected using SuperSignal West Pico or Femto Chemiluminescence kit (Thermo Fisher Scientific).
2.6. Comet Assay
Cells were treated with different DNA damage reagents and then harvested at the indicated time points for analysis. Cells (1 × 105 cells/mL in cold phosphate-buffered saline [PBS]) were resuspended in 1% low–melting agarose at 40 °C at a ratio of 1:3 vol/vol and pipetted onto a CometSlide. Slides were then immersed in prechilled lysis buffer (1.2 M NaCl, 100 mM EDTA, 0.1% sodium lauryl sarcosinate, 0.26 M NaOH pH > 13) for overnight (18–20 h) lysis at 4 °C in the dark. Slides were then carefully removed and submerged in rinse buffer (0.03 M NaOH and 2 mM EDTA, pH > 12) at room temperature (RT) for 20 min in the dark. This washing step was repeated twice. The slides were transferred to a horizontal electrophoresis chamber containing rinse buffer and separated for 25 min at a voltage of 0.6 V/cm. Finally, the slides were washed with distilled water, stained with 10 µg/mL propidium iodide, and analyzed by fluorescence microscopy. Twenty fields with approximately 100 cells in each sample were evaluated and quantified using the Fiji software to determine the tail length (tail moment).
2.7. Immunofluorescence
Cells were seeded on glass coverslips in a 12–well plate and transfected with the indicated plasmid for 24 h. Then, the cells were treated with or without DNA damage reagents according to the experimental setup. The cells were fixed in 4% paraformaldehyde (PFA) in PBS for 20 min at RT and then permeabilized in 0.5% Triton X–100 for 10 min. Slides were blocked in 5% normal goat serum (NGS) and incubated with primary antibodies diluted in 1% NGS overnight at 4 °C. Samples were then incubated with the indicated secondary antibodies labeled with Alexa Fluor 488 or 555 (Invitrogen) diluted in 1% NGS at RT for 1 h. Thereafter, they were stained with DAPI for 15 min at RT. Coverslips were mounted using Dako Fluorescence Mounting Medium (Agilent) and imaged using a Nikon confocal microscope (Eclipse C1 Plus). All scoring was performed under blinded conditions.
2.8. Analysis of V(D)J Recombination
Briefly, V(D)J reporter plasmid contains inverted-GFP and IRES driving continuously expressed RFP. Continuously expressed RFP is the internal transfection control. After Recombination activation gene1/2 (RAG1/2) co–transfected into the cells, RAG1/2 will cut the RSS and mediated induction of DSBs, if V(D)J recombination occurs, the inverted GFPs are ligated in positive order by NHEJ repair. Then the cell will express functional GFP. So, the GFP and RFP double positive cells are the readout of the V(D)J reporter assay [18]. 293T cells at 70% confluency were transfected with the V(D)J GFP reporter alone (background) or in combination with RAG1 and RAG2 expression constructs, at a ratio of 1 µg V(D)J GFP reporter: 0.5 µg RAG1: 0.5 µg RAG2. The following day, the medium was changed, and after an additional 48 h, cells were harvested and analyzed by flow cytometry for GFP and RFP expression.
2.9. Statistical Analysis
All experiments were repeated at least three times using independently collected or prepared samples. Data were analyzed by Student’s t test or ANOVA followed by Tukey’s multiple-comparison tests using GraphPad 8.
3. Results
3.1. Effect of Nuclear–Localized SARS–CoV–2 Viral Proteins on DNA Damage Repair
DNA damage repair occurs mainly in the nucleus to ensure genome stability. Although SARS–CoV–2 proteins are synthesized in the cytosol [1], some viral proteins are also detectable in the nucleus, including Nsp1, Nsp5, Nsp9, Nsp13, Nsp14, and Nsp16 [19]. We investigated whether these nuclear-localized SARS–CoV–2 proteins affect the host cell DNA damage repair system. For this, we constructed these viral protein expression plasmids together with spike and nucleoprotein expression plasmids, which are generally considered cytosol–localized proteins. We confirmed their expression and localization by immunoblotting and immunofluorescence (Figure 1A and Figure S1A). Our results were consistent with those from previous studies [19]; Nsp1, Nsp5, Nsp9, Nsp13, Nsp14, and Nsp16 proteins are indeed localized in the nucleus, and nucleoproteins are mainly localized in the cytosol. Surprisingly, we found the abundance of the spike protein in the nucleus (Figure 1A). NHEJ repair and homologous recombination (HR) repair are two major DNA repair pathways that not only continuously monitor and ensure genome integrity but are also vital for adaptive immune cell functions [9]. To evaluate whether these viral proteins impede the DSB repair pathway, we examined the repair of a site-specific DSB induced by the I–SceI endonuclease using the direct repeat–green fluorescence protein (DR–GFP) and the total-NHEJ-GFP (EJ5–GFP) reporter systems for HR and NHEJ, respectively [15,16]. Overexpression of Nsp1, Nsp5, Nsp13, Nsp14, and spike proteins diminished the efficiencies of both HR and NHEJ repair (Figure 1B–E and Figure S2A,B). Moreover, we also found that Nsp1, Nsp5, Nsp13, and Nsp14 overexpression dramatically suppressed proliferation compared with other studied proteins (Figure S3A,B). Therefore, the inhibitory effect of Nsp1, Nsp5, Nsp13, and Nsp14 on DNA damage repair may be due to secondary effects, such as growth arrest and cell death. Interestingly, overexpressed spike protein did not affect cell morphology or proliferation but significantly suppressed both HR and NHEJ repair (Figure 1B–E, Figures S2A,B and S3A,B).
3.2. SARS–CoV–2 Spike Protein Inhibits DNA Damage Repair
Because spike proteins are critical for mediating viral entry into host cells and are the focus of most vaccine strategies [20,21], we further investigated the role of spike proteins in DNA damage repair and its associated V(D)J recombination. Spike proteins are usually thought to be synthesized on the rough endoplasmic reticulum (ER) [1]. After posttranslational modifications such as glycosylation, spike proteins traffic via the cellular membrane apparatus together with other viral proteins to form the mature virion [1]. Spike protein contains two major subunits, S1 and S2, as well as several functional domains or repeats [22] (Figure 2A). In the native state, spike proteins exist as inactive full–length proteins. During viral infection, host cell proteases such as furin protease activate the S protein by cleaving it into S1 and S2 subunits, which is necessary for viral entry into the target cell [23]. We further explored different subunits of the spike protein to elucidate the functional features required for DNA repair inhibition. Only the full–length spike protein strongly inhibited both NHEJ and HR repair (Figure 2B–E and Figure S4A,B). Next, we sought to determine whether the spike protein directly contributes to genomic instability by inhibiting DSB repair. We monitored the levels of DSBs using comet assays. Following different DNA damage treatments, such as ?–irradiation, doxorubicin treatment, and H2O2 treatment, there is less repair in the presence of the spike protein (Figure 2F,G). Together, these data demonstrate that the spike protein directly affects DNA repair in the nucleus.
3.3. Spike Proteins Impede the Recruitment of DNA Damage Repair Checkpoint Proteins
To confirm the existence of spike protein in the nucleus, we performed subcellular fraction analysis and found that spike proteins are not only enriched in the cellular membrane fraction but are also abundant in the nuclear fraction, with detectable expression even in the chromatin–bound fraction (Figure 3A). We also observed that the spike has three different forms, the higher band is a highly glycosylated spike, the middle one is a full–length spike, and the lower one is a cleaved spike subunit. Consistent with the comet assay, we also found the upregulation of the DNA damage marker, ?–H2A.X, in spike protein–overexpressed cells under DNA damage conditions (Figure 3B). A recent study suggested that spike proteins induce ER stress and ER–associated protein degradation [24]. To exclude the possibility that the spike protein inhibits DNA repair by promoting DNA repair protein degradation, we checked the expression of some essential DNA repair proteins in NHEJ and HR repair pathways and found that these DNA repair proteins were stable after spike protein overexpression (Figure 3C). To determine how the spike protein inhibits both NHEJ and HR repair pathways, we analyzed the recruitment of BRCA1 and 53BP1, which are the key checkpoint proteins for HR and NHEJ repair, respectively. We found that the spike protein markedly inhibited both BRCA1 and 53BP1 foci formation (Figure 3D–G). Together, these data show that the SARS–CoV–2 full–length spike protein inhibits DNA damage repair by hindering DNA repair protein recruitment.
3.4. Spike Protein Impairs V(D)J Recombination In vitro
DNA damage repair, especially NHEJ repair, is essential for V(D)J recombination, which lies at the core of B and T cell immunity [9]. To date, many approved SARS–CoV–2 vaccines, such as mRNA vaccines and adenovirus–COVID–19 vaccines, have been developed based on the full–length spike protein [25]. Although it is debatable whether SARS–CoV–2 directly infects lymphocyte precursors [26,27], some reports have shown that infected cells secrete exosomes that can deliver SARS–CoV–2 RNA or protein to target cells [28,29]. We further tested whether the spike protein reduced NHEJ–mediated V(D)J recombination. For this, we designed an in vitro V(D)J recombination reporter system according to a previous study [18] (Figure S5). Compared with the empty vector, spike protein overexpression inhibited RAG–mediated V(D)J recombination in this in vitro reporter system (Figure 4).
4. Discussion
Our findings provide evidence of the spike protein hijacking the DNA damage repair machinery and adaptive immune machinery in vitro. We propose a potential mechanism by which spike proteins may impair adaptive immunity by inhibiting DNA damage repair. Although no evidence has been published that SARS–CoV–2 can infect thymocytes or bone marrow lymphoid cells, our in vitro V(D)J reporter assay shows that the spike protein intensely impeded V(D)J recombination. Consistent with our results, clinical observations also show that the risk of severe illness or death with COVID–19 increases with age, especially older adults who are at the highest risk [22]. This may be because SARS–CoV–2 spike proteins can weaken the DNA repair system of older people and consequently impede V(D)J recombination and adaptive immunity. In contrast, our data provide valuable details on the involvement of spike protein subunits in DNA damage repair, indicating that full–length spike–based vaccines may inhibit the recombination of V(D)J in B cells, which is also consistent with a recent study that a full–length spike–based vaccine induced lower antibody titers compared to the RBD–based vaccine [28]. This suggests that the use of antigenic epitopes of the spike as a SARS–CoV–2 vaccine might be safer and more efficacious than the full–length spike. Taken together, we identified one of the potentially important mechanisms of SARS–CoV–2 suppression of the host adaptive immune machinery. Furthermore, our findings also imply a potential side effect of the full–length spike–based vaccine. This work will improve the understanding of COVID–19 pathogenesis and provide new strategies for designing more efficient and safer vaccines.
Supplementary Materials
The following are available online at https://www.mdpi.com/article/10.3390/v13102056/s1, Figure S1: Expression of nuclear–localized SARS–CoV–2 proteins in human cells, Figure S2: Effect of nuclear SARS–CoV–2 proteins on NHEJ– and HR–DNA repair pathway, Figure S3: Nsp1, Nsp5, Nsp13, Nsp14 but not spike inhibit cell proliferation, Figure S4: Effect of SARS–CoV–2 spike mutants on NHEJ– and HR– DNA repair pathway, Figure S5: In vitro V(D)J recombination assay.
Author Contributions
H.J. conceived and designed the study. H.J. and Y.-F.M. supervised the study, performed experiments, and interpreted the data. Writing—original draft preparation, H.J.; Writing—review and editing, H.J. and Y.-F.M.; funding acquisition, Y.-F.M. All authors have read and agreed to the published version of the manuscript.
Funding
This work was supported by Umea University, Medical Faculty’s Planning grants for COVID–19 (research project number: 3453 16032 to Y.F.M.); the Lion’s Cancer Research Foundation at Umea University (grants: LP 17–2153, AMP 19–982, and LP 20–2256 to Y.F.M.), and the base unit’s ALF funds for research at academic healthcare units and university healthcare units in the northern healthcare region (ALF–Basenheten: 2019, 2020, 2021 to Y.F.M.).
Institutional Review Board Statement
Not applicable, because of this study not involving humans or animals.
Informed Consent Statement
Not applicable, because of this study not involving humans.
Data Availability Statement
The data presented in this study are available in the main text and Supplementary Materials.
Conflicts of Interest
The authors have declared that no competing interests exist. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
V’Kovski, P.; Kratzel, A.; Steiner, S.; Stalder, H.; Thiel, V. Coronavirus biology and replication: Implications for SARS-CoV-2. Nat. Rev. Microbiol. 2021, 19, 155–170. [Google Scholar] [CrossRef]
Suryawanshi, R.K.; Koganti, R.; Agelidis, A.; Patil, C.D.; Shukla, D. Dysregulation of Cell Signaling by SARS-CoV-2. Trends Microbiol. 2021, 29, 224–237. [Google Scholar] [CrossRef]
Qin, C.; Zhou, L.; Hu, Z.; Zhang, S.; Yang, S.; Tao, Y.; Xie, C.; Ma, K.; Shang, K.; Wang, W.; et al. Dysregulation of Immune Response in Patients With Coronavirus 2019 (COVID-19) in Wuhan, China. Clin. Infect. Dis. 2020, 71, 762–768. [Google Scholar] [CrossRef] [PubMed]
Wang, F.; Nie, J.; Wang, H.; Zhao, Q.; Xiong, Y.; Deng, L.; Song, S.; Ma, Z.; Mo, P.; Zhang, Y. Characteristics of Peripheral Lymphocyte Subset Alteration in COVID-19 Pneumonia. J. Infect. Dis. 2020, 221, 1762–1769. [Google Scholar] [CrossRef] [PubMed]
Zhang, G.; Nie, S.; Zhang, Z.; Zhang, Z. Longitudinal Change of Severe Acute Respiratory Syndrome Coronavirus 2 Antibodies in Patients with Coronavirus Disease 2019. J. Infect. Dis. 2020, 222, 183–188. [Google Scholar] [CrossRef] [PubMed]
Long, Q.X.; Liu, B.Z.; Deng, H.J.; Wu, G.C.; Deng, K.; Chen, Y.K.; Liao, P.; Qiu, J.F.; Lin, Y.; Cai, X.F.; et al. Antibody responses to SARS-CoV-2 in patients with COVID-19. Nat. Med. 2020, 26, 845–848. [Google Scholar] [CrossRef]
Bednarski, J.J.; Sleckman, B.P. Lymphocyte development: Integration of DNA damage response signaling. Adv. Immunol. 2012, 116, 175–204. [Google Scholar] [PubMed]
Malu, S.; Malshetty, V.; Francis, D.; Cortes, P. Role of non-homologous end joining in V(D)J recombination. Immunol. Res. 2012, 54, 233–246. [Google Scholar] [CrossRef]
Bednarski, J.J.; Sleckman, B.P. At the intersection of DNA damage and immune responses. Nat. Rev. Immunol. 2019, 19, 231–242. [Google Scholar] [CrossRef]
Gapud, E.J.; Sleckman, B.P. Unique and redundant functions of ATM and DNA-PKcs during V(D)J recombination. Cell. Cycle 2011, 10, 1928–1935. [Google Scholar] [CrossRef]
Difilippantonio, S.; Gapud, E.; Wong, N.; Huang, C.Y.; Mahowald, G.; Chen, H.T.; Kruhlak, M.J.; Callen, E.; Livak, F.; Nussenzweig, M.C.; et al. 53BP1 facilitates long-range DNA end-joining during V(D)J recombination. Nature 2008, 456, 529–533. [Google Scholar] [CrossRef] [PubMed]
Schwarz, K.B. Oxidative stress during viral infection: A review. Free Radic. Biol. Med. 1996, 21, 641–649. [Google Scholar] [CrossRef]
Xu, L.H.; Huang, M.; Fang, S.G.; Liu, D.X. Coronavirus infection induces DNA replication stress partly through interaction of its nonstructural protein 13 with the p125 subunit of DNA polymerase delta. J. Biol. Chem. 2011, 286, 39546–39559. [Google Scholar] [CrossRef] [PubMed]
Delgado-Roche, L.; Mesta, F. Oxidative Stress as Key Player in Severe Acute Respiratory Syndrome Coronavirus (SARS-CoV) Infection. Arch. Med. Res. 2020, 51, 384–387. [Google Scholar] [CrossRef] [PubMed]
Pierce, A.J.; Hu, P.; Han, M.; Ellis, N.; Jasin, M. Ku DNA end-binding protein modulates homologous repair of double-strand breaks in mammalian cells. Genes Dev. 2001, 15, 3237–3242. [Google Scholar] [CrossRef]
Bennardo, N.; Cheng, A.; Huang, N.; Stark, J.M. Alternative-NHEJ is a mechanistically distinct pathway of mammalian chromosome break repair. PLoS Genet. 2008, 4, e1000110. [Google Scholar] [CrossRef]
Sadofsky, M.J.; Hesse, J.E.; McBlane, J.F.; Gellert, M. Expression and V(D)J recombination activity of mutated RAG-1 proteins. Nucleic Acids Res. 1993, 21, 5644–5650. [Google Scholar] [CrossRef]
Trancoso, I.; Bonnet, M.; Gardner, R.; Carneiro, J.; Barreto, V.; Demengeot, J.; Sarmento, L. A Novel Quantitative Fluorescent Reporter Assay for RAG Targets and RAG Activity. Front. Immunol. 2013, 4, 110. [Google Scholar] [CrossRef]
Zhang, J.; Cruz-cosme, R.; Zhuang, M.-W.; Liu, D.; Liu, Y.; Teng, S.; Wang, P.-H.; Tang, Q. A systemic and molecular study of subcellular localization of SARS-CoV-2 proteins. Signal Transduct. Target. Ther. 2020, 5, 269. [Google Scholar] [CrossRef]
Shang, J.; Wan, Y.; Luo, C.; Ye, G.; Geng, Q.; Auerbach, A.; Li, F. Cell entry mechanisms of SARS-CoV-2. Proc. Natl. Acad. Sci. USA 2020, 117, 11727–11734. [Google Scholar] [CrossRef]
Du, L.; He, Y.; Zhou, Y.; Liu, S.; Zheng, B.J.; Jiang, S. The spike protein of SARS-CoV—A target for vaccine and therapeutic development. Nat. Rev. Microbiol. 2009, 7, 226–236. [Google Scholar] [CrossRef] [PubMed]
Huang, Y.; Yang, C.; Xu, X.F.; Xu, W.; Liu, S.W. Structural and functional properties of SARS-CoV-2 spike protein: Potential antivirus drug development for COVID-19. Acta Pharmacol. Sin. 2020, 41, 1141–1149. [Google Scholar] [CrossRef] [PubMed]
Hoffmann, M.; Kleine-Weber, H.; Schroeder, S.; Kruger, N.; Herrler, T.; Erichsen, S.; Schiergens, T.S.; Herrler, G.; Wu, N.H.; Nitsche, A.; et al. SARS-CoV-2 Cell Entry Depends on ACE2 and TMPRSS2 and Is Blocked by a Clinically Proven Protease Inhibitor. Cell 2020, 181, 271–280.e8. [Google Scholar] [CrossRef]
Hsu, A.C.-Y.; Wang, G.; Reid, A.T.; Veerati, P.C.; Pathinayake, P.S.; Daly, K.; Mayall, J.R.; Hansbro, P.M.; Horvat, J.C.; Wang, F.; et al. SARS-CoV-2 Spike protein promotes hyper-inflammatory response that can be ameliorated by Spike-antagonistic peptide and FDA-approved ER stress and MAP kinase inhibitors in vitro. bioRxiv 2020, 2020, 317818. [Google Scholar]
Poland, G.A.; Ovsyannikova, I.G.; Kennedy, R.B. SARS-CoV-2 immunity: Review and applications to phase 3 vaccine candidates. Lancet 2020, 396, 1595–1606. [Google Scholar] [CrossRef]
Davanzo, G.G.; Codo, A.C.; Brunetti, N.S.; Boldrini, V.; Knittel, T.L.; Monterio, L.B.; de Moraes, D.; Ferrari, A.J.R.; de Souza, G.F.; Muraro, S.P.; et al. SARS-CoV-2 Uses CD4 to Infect T Helper Lymphocytes. medRxiv 2020, 2020, 20200329. [Google Scholar]
Borsa, M.; Mazet, J.M. Attacking the defence: SARS-CoV-2 can infect immune cells. Nat. Rev. Immunol. 2020, 20, 592. [Google Scholar] [CrossRef]
Barberis, E.; Vanella, V.V.; Falasca, M.; Caneapero, V.; Cappellano, G.; Raineri, D.; Ghirimoldi, M.; De Giorgis, V.; Puricelli, C.; Vaschetto, R.; et al. Circulating Exosomes Are Strongly Involved in SARS-CoV-2 Infection. Front. Mol. Biosci. 2021, 8, 632290. [Google Scholar] [CrossRef]
Sur, S.; Khatun, M.; Steele, R.; Isbell, T.S.; Ray, R.; Ray, R.B. Exosomes from COVID-19 patients carry tenascin-C and fibrinogen-ß in triggering inflammatory signals in distant organ cells. bioRxiv 2021, 2021, 430369. [Google Scholar]"
You are becoming older as far as 50% death in 5 years is predictable with 100% efficacy. Explosion of cancer and accute "oldering" and unrepairable DNA damage "DNA holocaust" yet proof. Justice Departments and tribunals are prepared? Pfizer-Biontech, Moderna etc.,COVAX, GAVI as a whole and other 14 vaccines producents have serious problem. People don´t asleep! It may not only kill Bill.
Shocking Research what mRNA SpikeProtein inflicts to your body, DNA, NHEJ reparation and "oldering":
" MDPI - Viruses
https://www.mdpi.com/1999-4915/13/10/2056/htm
https://www.naturalnews.com/files/viruses-13-02056-v2.pdf
Open AccessArticle
SARS–CoV–2 Spike Impairs DNA Damage Repair and Inhibits V(D)J Recombination In Vitro
by Hui Jiang
1,2,* and Ya-Fang Mei
2,*
1
Department of Molecular Biosciences, The Wenner–Gren Institute, Stockholm University, SE-10691 Stockholm, Sweden
2
Department of Clinical Microbiology, Virology, Umea University, SE-90185 Umea, Sweden
*
Authors to whom correspondence should be addressed.
Academic Editor: Oliver Schildgen
Viruses 2021, 13(10), 2056; https://doi.org/10.3390/v13102056
Received: 20 August 2021 / Revised: 8 September 2021 / Accepted: 8 October 2021 / Published: 13 October 2021
This article belongs to the Special Issue SARS-CoV-2 Host Cell Interactions
Abstract
Severe acute respiratory syndrome coronavirus 2 (SARS–CoV–2) has led to the coronavirus disease 2019 (COVID–19) pandemic, severely affecting public health and the global economy. Adaptive immunity plays a crucial role in fighting against SARS–CoV–2 infection and directly influences the clinical outcomes of patients. Clinical studies have indicated that patients with severe COVID–19 exhibit delayed and weak adaptive immune responses; however, the mechanism by which SARS–CoV–2 impedes adaptive immunity remains unclear. Here, by using an in vitro cell line, we report that the SARS–CoV–2 spike protein significantly inhibits DNA damage repair, which is required for effective V(D)J recombination in adaptive immunity. Mechanistically, we found that the spike protein localizes in the nucleus and inhibits DNA damage repair by impeding key DNA repair protein BRCA1 and 53BP1 recruitment to the damage site. Our findings reveal a potential molecular mechanism by which the spike protein might impede adaptive immunity and underscore the potential side effects of full-length spike-based vaccines.
Keywords: SARS–CoV–2; spike; DNA damage repair; V(D)J recombination; vaccine
1. Introduction
Severe acute respiratory syndrome coronavirus 2 (SARS–CoV–2) is responsible for the ongoing coronavirus disease 2019 (COVID–19) pandemic that has resulted in more than 2.3 million deaths. SARS–CoV–2 is an enveloped single positive–sense RNA virus that consists of structural and non–structural proteins [1]. After infection, these viral proteins hijack and dysregulate the host cellular machinery to replicate, assemble, and spread progeny viruses [2]. Recent clinical studies have shown that SARS–CoV–2 infection extraordinarily affects lymphocyte number and function [3,4,5,6]. Compared with mild and moderate survivors, patients with severe COVID–19 manifest a significantly lower number of total T cells, helper T cells, and suppressor T cells [3,4]. Additionally, COVID–19 delays IgG and IgM levels after symptom onset [5,6]. Collectively, these clinical observations suggest that SARS–CoV–2 affects the adaptive immune system. However, the mechanism by which SARS–CoV–2 suppresses adaptive immunity remains unclear.
As two critical host surveillance systems, the immune and DNA repair systems are the primary systems that higher organisms rely on for defense against diverse threats and tissue homeostasis. Emerging evidence indicates that these two systems are interdependent, especially during lymphocyte development and maturation [7]. As one of the major double-strand DNA break (DSB) repair pathways, non-homologous end joining (NHEJ) repair plays a critical role in lymphocyte–specific recombination–activating gene endonuclease (RAG) –mediated V(D)J recombination, which results in a highly diverse repertoire of antibodies in B cell and T cell receptors (TCRs) in T cells [8]. For example, loss of function of key DNA repair proteins such as ATM, DNA–PKcs, 53BP1, et al., leads to defects in the NHEJ repair which inhibit the production of functional B and T cells, leading to immunodeficiency [7,9,10,11]. In contrast, viral infection usually induces DNA damage via different mechanisms, such as inducing reactive oxygen species (ROS) production and host cell replication stress [12,13,14]. If DNA damage cannot be properly repaired, it will contribute to the amplification of viral infection-induced pathology. Therefore, we aimed to investigate whether SARS–CoV–2 proteins hijack the DNA damage repair system, thereby affecting adaptive immunity in vitro.
2. Materials and Methods
2.1. Antibodies and Reagents
DAPI (Cat #MBD0015), doxorubicin (Cat #D1515), H2O2 (Cat #H1009), and ß-tubulin antibodies (Cat #T4026) were purchased from Sigma-Aldrich. Antibodies against His tag (Cat #12698), H2A (Cat #12349), H2A.X (Cat #7631), ?–H2A.X (Cat #2577), Ku80 (Cat # 2753), and Rad51(Cat #8875) were purchased from Cell Signaling Technology (Danvers, MA, USA). 53BP1(Cat #NB100-304) and RNF168 (Cat #H00165918–M01) antibodies were obtained from Novus Biologicals (Novus Biologicals, Littleton, CO, USA). Lamin B (Cat #sc–374015), ATM (Cat #sc–135663), DNA–PK (Cat #sc–5282), and BRCA1(Cat #sc–28383) antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). XRCC4 (Cat #PA5–82264) antibody was purchased from Thermo Fisher Scientific (Waltham, MA, USA).
2.2. Plasmids
pHPRT–DRGFP and pCBASceI were kindly gifted by Maria Jasin (Addgene plasmids #26476 and #26477) [15]. pimEJ5GFP was a gift from Jeremy Stark (Addgene plasmid #44026) [16]. The NSP1, NSP9, NSP13, NSP14, NSP16, spike, and nucleocapsid proteins were first synthesized with codon optimization and then cloned into a mammalian expression vector pUC57 with a C–terminal 6xHis tag. A 12–spacer RSS–GFP inverted complementary sequence–a 23–spacer RSS was synthesized for the V(D)J reporter vector. Then, the sequence was cloned into the pBabe–IRES–mRFP vector to generate the pBabe–12RSS–GFPi–23RSS–IRES–mRFP reporter vector. 12–spacer RSS sequence: 5'–CACAGTGCTACAGACTGGAACAAAAACC–3'. 23–spacer RSS sequence: 5'–CACAGTGGTAGTACTCCACTGTCTGGCTGTACAAAAACC–3'. RAG1 and RAG2 expression constructs were generously gifted by Martin Gellert (Addgene plasmid #13328 and #13329) [17].
2.3. Cells and Cell Culture
HEK293T and HEK293 cells obtained from the American Type Culture Collection (ATCC) were cultured under 5% CO2 at 37 °C in Dulbecco’s modified Eagle’s medium (DMEM, high glucose, GlutaMAX) (Life Technologies, Carlsbad, CA, USA) containing 10% (v/v) fetal calf serum (FCS, Gibco), 1% (v/v) penicillin (100 IU/mL), and streptomycin (100?µg/mL). HEK293T–DR–GFP and HEK293T–EJ5–GFP reporter cells were generated as previously described and cultured under 5% CO2 at 37 °C in the above-mentioned culture medium.
2.4. HR and NHEJ Reporter Assays
HR and NHEJ repair in HEK293T cells were measured as described previously using DR–GFP and EJ5–GFP stable cells. Briefly, 0.5 × 106 HEK293T stable reporter cells were seeded in 6–well plates and transfected with 2 µg I–SceI expression plasmid (pCBASceI) together with SARS–CoV–2 proteins expression plasmids. Forty–eight hours post–transfection and aspirin treatment, cells were harvested and analyzed by flow cytometry analysis for GFP expression. The means were obtained from three independent experiments.
2.5. Cellular Fractionation and Immunoblotting
For the cellular fraction assay, the Subcellular Protein Fractionation Kit (Thermo Fisher) was used according to the manufacturer’s instructions. Protein lysates were quantified using the BCA reagent (Thermo Fisher Scientific, Rockford, IL, USA). Proteins were resolved by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE), transferred to nitrocellulose membranes (Amersham protran, 0.45 µm NC), and immunoblotted with specific primary antibodies followed by HRP–conjugated secondary antibodies. Protein bands were detected using SuperSignal West Pico or Femto Chemiluminescence kit (Thermo Fisher Scientific).
2.6. Comet Assay
Cells were treated with different DNA damage reagents and then harvested at the indicated time points for analysis. Cells (1 × 105 cells/mL in cold phosphate-buffered saline [PBS]) were resuspended in 1% low–melting agarose at 40 °C at a ratio of 1:3 vol/vol and pipetted onto a CometSlide. Slides were then immersed in prechilled lysis buffer (1.2 M NaCl, 100 mM EDTA, 0.1% sodium lauryl sarcosinate, 0.26 M NaOH pH > 13) for overnight (18–20 h) lysis at 4 °C in the dark. Slides were then carefully removed and submerged in rinse buffer (0.03 M NaOH and 2 mM EDTA, pH > 12) at room temperature (RT) for 20 min in the dark. This washing step was repeated twice. The slides were transferred to a horizontal electrophoresis chamber containing rinse buffer and separated for 25 min at a voltage of 0.6 V/cm. Finally, the slides were washed with distilled water, stained with 10 µg/mL propidium iodide, and analyzed by fluorescence microscopy. Twenty fields with approximately 100 cells in each sample were evaluated and quantified using the Fiji software to determine the tail length (tail moment).
2.7. Immunofluorescence
Cells were seeded on glass coverslips in a 12–well plate and transfected with the indicated plasmid for 24 h. Then, the cells were treated with or without DNA damage reagents according to the experimental setup. The cells were fixed in 4% paraformaldehyde (PFA) in PBS for 20 min at RT and then permeabilized in 0.5% Triton X–100 for 10 min. Slides were blocked in 5% normal goat serum (NGS) and incubated with primary antibodies diluted in 1% NGS overnight at 4 °C. Samples were then incubated with the indicated secondary antibodies labeled with Alexa Fluor 488 or 555 (Invitrogen) diluted in 1% NGS at RT for 1 h. Thereafter, they were stained with DAPI for 15 min at RT. Coverslips were mounted using Dako Fluorescence Mounting Medium (Agilent) and imaged using a Nikon confocal microscope (Eclipse C1 Plus). All scoring was performed under blinded conditions.
2.8. Analysis of V(D)J Recombination
Briefly, V(D)J reporter plasmid contains inverted-GFP and IRES driving continuously expressed RFP. Continuously expressed RFP is the internal transfection control. After Recombination activation gene1/2 (RAG1/2) co–transfected into the cells, RAG1/2 will cut the RSS and mediated induction of DSBs, if V(D)J recombination occurs, the inverted GFPs are ligated in positive order by NHEJ repair. Then the cell will express functional GFP. So, the GFP and RFP double positive cells are the readout of the V(D)J reporter assay [18]. 293T cells at 70% confluency were transfected with the V(D)J GFP reporter alone (background) or in combination with RAG1 and RAG2 expression constructs, at a ratio of 1 µg V(D)J GFP reporter: 0.5 µg RAG1: 0.5 µg RAG2. The following day, the medium was changed, and after an additional 48 h, cells were harvested and analyzed by flow cytometry for GFP and RFP expression.
2.9. Statistical Analysis
All experiments were repeated at least three times using independently collected or prepared samples. Data were analyzed by Student’s t test or ANOVA followed by Tukey’s multiple-comparison tests using GraphPad 8.
3. Results
3.1. Effect of Nuclear–Localized SARS–CoV–2 Viral Proteins on DNA Damage Repair
DNA damage repair occurs mainly in the nucleus to ensure genome stability. Although SARS–CoV–2 proteins are synthesized in the cytosol [1], some viral proteins are also detectable in the nucleus, including Nsp1, Nsp5, Nsp9, Nsp13, Nsp14, and Nsp16 [19]. We investigated whether these nuclear-localized SARS–CoV–2 proteins affect the host cell DNA damage repair system. For this, we constructed these viral protein expression plasmids together with spike and nucleoprotein expression plasmids, which are generally considered cytosol–localized proteins. We confirmed their expression and localization by immunoblotting and immunofluorescence (Figure 1A and Figure S1A). Our results were consistent with those from previous studies [19]; Nsp1, Nsp5, Nsp9, Nsp13, Nsp14, and Nsp16 proteins are indeed localized in the nucleus, and nucleoproteins are mainly localized in the cytosol. Surprisingly, we found the abundance of the spike protein in the nucleus (Figure 1A). NHEJ repair and homologous recombination (HR) repair are two major DNA repair pathways that not only continuously monitor and ensure genome integrity but are also vital for adaptive immune cell functions [9]. To evaluate whether these viral proteins impede the DSB repair pathway, we examined the repair of a site-specific DSB induced by the I–SceI endonuclease using the direct repeat–green fluorescence protein (DR–GFP) and the total-NHEJ-GFP (EJ5–GFP) reporter systems for HR and NHEJ, respectively [15,16]. Overexpression of Nsp1, Nsp5, Nsp13, Nsp14, and spike proteins diminished the efficiencies of both HR and NHEJ repair (Figure 1B–E and Figure S2A,B). Moreover, we also found that Nsp1, Nsp5, Nsp13, and Nsp14 overexpression dramatically suppressed proliferation compared with other studied proteins (Figure S3A,B). Therefore, the inhibitory effect of Nsp1, Nsp5, Nsp13, and Nsp14 on DNA damage repair may be due to secondary effects, such as growth arrest and cell death. Interestingly, overexpressed spike protein did not affect cell morphology or proliferation but significantly suppressed both HR and NHEJ repair (Figure 1B–E, Figures S2A,B and S3A,B).
3.2. SARS–CoV–2 Spike Protein Inhibits DNA Damage Repair
Because spike proteins are critical for mediating viral entry into host cells and are the focus of most vaccine strategies [20,21], we further investigated the role of spike proteins in DNA damage repair and its associated V(D)J recombination. Spike proteins are usually thought to be synthesized on the rough endoplasmic reticulum (ER) [1]. After posttranslational modifications such as glycosylation, spike proteins traffic via the cellular membrane apparatus together with other viral proteins to form the mature virion [1]. Spike protein contains two major subunits, S1 and S2, as well as several functional domains or repeats [22] (Figure 2A). In the native state, spike proteins exist as inactive full–length proteins. During viral infection, host cell proteases such as furin protease activate the S protein by cleaving it into S1 and S2 subunits, which is necessary for viral entry into the target cell [23]. We further explored different subunits of the spike protein to elucidate the functional features required for DNA repair inhibition. Only the full–length spike protein strongly inhibited both NHEJ and HR repair (Figure 2B–E and Figure S4A,B). Next, we sought to determine whether the spike protein directly contributes to genomic instability by inhibiting DSB repair. We monitored the levels of DSBs using comet assays. Following different DNA damage treatments, such as ?–irradiation, doxorubicin treatment, and H2O2 treatment, there is less repair in the presence of the spike protein (Figure 2F,G). Together, these data demonstrate that the spike protein directly affects DNA repair in the nucleus.
3.3. Spike Proteins Impede the Recruitment of DNA Damage Repair Checkpoint Proteins
To confirm the existence of spike protein in the nucleus, we performed subcellular fraction analysis and found that spike proteins are not only enriched in the cellular membrane fraction but are also abundant in the nuclear fraction, with detectable expression even in the chromatin–bound fraction (Figure 3A). We also observed that the spike has three different forms, the higher band is a highly glycosylated spike, the middle one is a full–length spike, and the lower one is a cleaved spike subunit. Consistent with the comet assay, we also found the upregulation of the DNA damage marker, ?–H2A.X, in spike protein–overexpressed cells under DNA damage conditions (Figure 3B). A recent study suggested that spike proteins induce ER stress and ER–associated protein degradation [24]. To exclude the possibility that the spike protein inhibits DNA repair by promoting DNA repair protein degradation, we checked the expression of some essential DNA repair proteins in NHEJ and HR repair pathways and found that these DNA repair proteins were stable after spike protein overexpression (Figure 3C). To determine how the spike protein inhibits both NHEJ and HR repair pathways, we analyzed the recruitment of BRCA1 and 53BP1, which are the key checkpoint proteins for HR and NHEJ repair, respectively. We found that the spike protein markedly inhibited both BRCA1 and 53BP1 foci formation (Figure 3D–G). Together, these data show that the SARS–CoV–2 full–length spike protein inhibits DNA damage repair by hindering DNA repair protein recruitment.
3.4. Spike Protein Impairs V(D)J Recombination In vitro
DNA damage repair, especially NHEJ repair, is essential for V(D)J recombination, which lies at the core of B and T cell immunity [9]. To date, many approved SARS–CoV–2 vaccines, such as mRNA vaccines and adenovirus–COVID–19 vaccines, have been developed based on the full–length spike protein [25]. Although it is debatable whether SARS–CoV–2 directly infects lymphocyte precursors [26,27], some reports have shown that infected cells secrete exosomes that can deliver SARS–CoV–2 RNA or protein to target cells [28,29]. We further tested whether the spike protein reduced NHEJ–mediated V(D)J recombination. For this, we designed an in vitro V(D)J recombination reporter system according to a previous study [18] (Figure S5). Compared with the empty vector, spike protein overexpression inhibited RAG–mediated V(D)J recombination in this in vitro reporter system (Figure 4).
4. Discussion
Our findings provide evidence of the spike protein hijacking the DNA damage repair machinery and adaptive immune machinery in vitro. We propose a potential mechanism by which spike proteins may impair adaptive immunity by inhibiting DNA damage repair. Although no evidence has been published that SARS–CoV–2 can infect thymocytes or bone marrow lymphoid cells, our in vitro V(D)J reporter assay shows that the spike protein intensely impeded V(D)J recombination. Consistent with our results, clinical observations also show that the risk of severe illness or death with COVID–19 increases with age, especially older adults who are at the highest risk [22]. This may be because SARS–CoV–2 spike proteins can weaken the DNA repair system of older people and consequently impede V(D)J recombination and adaptive immunity. In contrast, our data provide valuable details on the involvement of spike protein subunits in DNA damage repair, indicating that full–length spike–based vaccines may inhibit the recombination of V(D)J in B cells, which is also consistent with a recent study that a full–length spike–based vaccine induced lower antibody titers compared to the RBD–based vaccine [28]. This suggests that the use of antigenic epitopes of the spike as a SARS–CoV–2 vaccine might be safer and more efficacious than the full–length spike. Taken together, we identified one of the potentially important mechanisms of SARS–CoV–2 suppression of the host adaptive immune machinery. Furthermore, our findings also imply a potential side effect of the full–length spike–based vaccine. This work will improve the understanding of COVID–19 pathogenesis and provide new strategies for designing more efficient and safer vaccines.
Supplementary Materials
The following are available online at https://www.mdpi.com/article/10.3390/v13102056/s1, Figure S1: Expression of nuclear–localized SARS–CoV–2 proteins in human cells, Figure S2: Effect of nuclear SARS–CoV–2 proteins on NHEJ– and HR–DNA repair pathway, Figure S3: Nsp1, Nsp5, Nsp13, Nsp14 but not spike inhibit cell proliferation, Figure S4: Effect of SARS–CoV–2 spike mutants on NHEJ– and HR– DNA repair pathway, Figure S5: In vitro V(D)J recombination assay.
Author Contributions
H.J. conceived and designed the study. H.J. and Y.-F.M. supervised the study, performed experiments, and interpreted the data. Writing—original draft preparation, H.J.; Writing—review and editing, H.J. and Y.-F.M.; funding acquisition, Y.-F.M. All authors have read and agreed to the published version of the manuscript.
Funding
This work was supported by Umea University, Medical Faculty’s Planning grants for COVID–19 (research project number: 3453 16032 to Y.F.M.); the Lion’s Cancer Research Foundation at Umea University (grants: LP 17–2153, AMP 19–982, and LP 20–2256 to Y.F.M.), and the base unit’s ALF funds for research at academic healthcare units and university healthcare units in the northern healthcare region (ALF–Basenheten: 2019, 2020, 2021 to Y.F.M.).
Institutional Review Board Statement
Not applicable, because of this study not involving humans or animals.
Informed Consent Statement
Not applicable, because of this study not involving humans.
Data Availability Statement
The data presented in this study are available in the main text and Supplementary Materials.
Conflicts of Interest
The authors have declared that no competing interests exist. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
V’Kovski, P.; Kratzel, A.; Steiner, S.; Stalder, H.; Thiel, V. Coronavirus biology and replication: Implications for SARS-CoV-2. Nat. Rev. Microbiol. 2021, 19, 155–170. [Google Scholar] [CrossRef]
Suryawanshi, R.K.; Koganti, R.; Agelidis, A.; Patil, C.D.; Shukla, D. Dysregulation of Cell Signaling by SARS-CoV-2. Trends Microbiol. 2021, 29, 224–237. [Google Scholar] [CrossRef]
Qin, C.; Zhou, L.; Hu, Z.; Zhang, S.; Yang, S.; Tao, Y.; Xie, C.; Ma, K.; Shang, K.; Wang, W.; et al. Dysregulation of Immune Response in Patients With Coronavirus 2019 (COVID-19) in Wuhan, China. Clin. Infect. Dis. 2020, 71, 762–768. [Google Scholar] [CrossRef] [PubMed]
Wang, F.; Nie, J.; Wang, H.; Zhao, Q.; Xiong, Y.; Deng, L.; Song, S.; Ma, Z.; Mo, P.; Zhang, Y. Characteristics of Peripheral Lymphocyte Subset Alteration in COVID-19 Pneumonia. J. Infect. Dis. 2020, 221, 1762–1769. [Google Scholar] [CrossRef] [PubMed]
Zhang, G.; Nie, S.; Zhang, Z.; Zhang, Z. Longitudinal Change of Severe Acute Respiratory Syndrome Coronavirus 2 Antibodies in Patients with Coronavirus Disease 2019. J. Infect. Dis. 2020, 222, 183–188. [Google Scholar] [CrossRef] [PubMed]
Long, Q.X.; Liu, B.Z.; Deng, H.J.; Wu, G.C.; Deng, K.; Chen, Y.K.; Liao, P.; Qiu, J.F.; Lin, Y.; Cai, X.F.; et al. Antibody responses to SARS-CoV-2 in patients with COVID-19. Nat. Med. 2020, 26, 845–848. [Google Scholar] [CrossRef]
Bednarski, J.J.; Sleckman, B.P. Lymphocyte development: Integration of DNA damage response signaling. Adv. Immunol. 2012, 116, 175–204. [Google Scholar] [PubMed]
Malu, S.; Malshetty, V.; Francis, D.; Cortes, P. Role of non-homologous end joining in V(D)J recombination. Immunol. Res. 2012, 54, 233–246. [Google Scholar] [CrossRef]
Bednarski, J.J.; Sleckman, B.P. At the intersection of DNA damage and immune responses. Nat. Rev. Immunol. 2019, 19, 231–242. [Google Scholar] [CrossRef]
Gapud, E.J.; Sleckman, B.P. Unique and redundant functions of ATM and DNA-PKcs during V(D)J recombination. Cell. Cycle 2011, 10, 1928–1935. [Google Scholar] [CrossRef]
Difilippantonio, S.; Gapud, E.; Wong, N.; Huang, C.Y.; Mahowald, G.; Chen, H.T.; Kruhlak, M.J.; Callen, E.; Livak, F.; Nussenzweig, M.C.; et al. 53BP1 facilitates long-range DNA end-joining during V(D)J recombination. Nature 2008, 456, 529–533. [Google Scholar] [CrossRef] [PubMed]
Schwarz, K.B. Oxidative stress during viral infection: A review. Free Radic. Biol. Med. 1996, 21, 641–649. [Google Scholar] [CrossRef]
Xu, L.H.; Huang, M.; Fang, S.G.; Liu, D.X. Coronavirus infection induces DNA replication stress partly through interaction of its nonstructural protein 13 with the p125 subunit of DNA polymerase delta. J. Biol. Chem. 2011, 286, 39546–39559. [Google Scholar] [CrossRef] [PubMed]
Delgado-Roche, L.; Mesta, F. Oxidative Stress as Key Player in Severe Acute Respiratory Syndrome Coronavirus (SARS-CoV) Infection. Arch. Med. Res. 2020, 51, 384–387. [Google Scholar] [CrossRef] [PubMed]
Pierce, A.J.; Hu, P.; Han, M.; Ellis, N.; Jasin, M. Ku DNA end-binding protein modulates homologous repair of double-strand breaks in mammalian cells. Genes Dev. 2001, 15, 3237–3242. [Google Scholar] [CrossRef]
Bennardo, N.; Cheng, A.; Huang, N.; Stark, J.M. Alternative-NHEJ is a mechanistically distinct pathway of mammalian chromosome break repair. PLoS Genet. 2008, 4, e1000110. [Google Scholar] [CrossRef]
Sadofsky, M.J.; Hesse, J.E.; McBlane, J.F.; Gellert, M. Expression and V(D)J recombination activity of mutated RAG-1 proteins. Nucleic Acids Res. 1993, 21, 5644–5650. [Google Scholar] [CrossRef]
Trancoso, I.; Bonnet, M.; Gardner, R.; Carneiro, J.; Barreto, V.; Demengeot, J.; Sarmento, L. A Novel Quantitative Fluorescent Reporter Assay for RAG Targets and RAG Activity. Front. Immunol. 2013, 4, 110. [Google Scholar] [CrossRef]
Zhang, J.; Cruz-cosme, R.; Zhuang, M.-W.; Liu, D.; Liu, Y.; Teng, S.; Wang, P.-H.; Tang, Q. A systemic and molecular study of subcellular localization of SARS-CoV-2 proteins. Signal Transduct. Target. Ther. 2020, 5, 269. [Google Scholar] [CrossRef]
Shang, J.; Wan, Y.; Luo, C.; Ye, G.; Geng, Q.; Auerbach, A.; Li, F. Cell entry mechanisms of SARS-CoV-2. Proc. Natl. Acad. Sci. USA 2020, 117, 11727–11734. [Google Scholar] [CrossRef]
Du, L.; He, Y.; Zhou, Y.; Liu, S.; Zheng, B.J.; Jiang, S. The spike protein of SARS-CoV—A target for vaccine and therapeutic development. Nat. Rev. Microbiol. 2009, 7, 226–236. [Google Scholar] [CrossRef] [PubMed]
Huang, Y.; Yang, C.; Xu, X.F.; Xu, W.; Liu, S.W. Structural and functional properties of SARS-CoV-2 spike protein: Potential antivirus drug development for COVID-19. Acta Pharmacol. Sin. 2020, 41, 1141–1149. [Google Scholar] [CrossRef] [PubMed]
Hoffmann, M.; Kleine-Weber, H.; Schroeder, S.; Kruger, N.; Herrler, T.; Erichsen, S.; Schiergens, T.S.; Herrler, G.; Wu, N.H.; Nitsche, A.; et al. SARS-CoV-2 Cell Entry Depends on ACE2 and TMPRSS2 and Is Blocked by a Clinically Proven Protease Inhibitor. Cell 2020, 181, 271–280.e8. [Google Scholar] [CrossRef]
Hsu, A.C.-Y.; Wang, G.; Reid, A.T.; Veerati, P.C.; Pathinayake, P.S.; Daly, K.; Mayall, J.R.; Hansbro, P.M.; Horvat, J.C.; Wang, F.; et al. SARS-CoV-2 Spike protein promotes hyper-inflammatory response that can be ameliorated by Spike-antagonistic peptide and FDA-approved ER stress and MAP kinase inhibitors in vitro. bioRxiv 2020, 2020, 317818. [Google Scholar]
Poland, G.A.; Ovsyannikova, I.G.; Kennedy, R.B. SARS-CoV-2 immunity: Review and applications to phase 3 vaccine candidates. Lancet 2020, 396, 1595–1606. [Google Scholar] [CrossRef]
Davanzo, G.G.; Codo, A.C.; Brunetti, N.S.; Boldrini, V.; Knittel, T.L.; Monterio, L.B.; de Moraes, D.; Ferrari, A.J.R.; de Souza, G.F.; Muraro, S.P.; et al. SARS-CoV-2 Uses CD4 to Infect T Helper Lymphocytes. medRxiv 2020, 2020, 20200329. [Google Scholar]
Borsa, M.; Mazet, J.M. Attacking the defence: SARS-CoV-2 can infect immune cells. Nat. Rev. Immunol. 2020, 20, 592. [Google Scholar] [CrossRef]
Barberis, E.; Vanella, V.V.; Falasca, M.; Caneapero, V.; Cappellano, G.; Raineri, D.; Ghirimoldi, M.; De Giorgis, V.; Puricelli, C.; Vaschetto, R.; et al. Circulating Exosomes Are Strongly Involved in SARS-CoV-2 Infection. Front. Mol. Biosci. 2021, 8, 632290. [Google Scholar] [CrossRef]
Sur, S.; Khatun, M.; Steele, R.; Isbell, T.S.; Ray, R.; Ray, R.B. Exosomes from COVID-19 patients carry tenascin-C and fibrinogen-ß in triggering inflammatory signals in distant organ cells. bioRxiv 2021, 2021, 430369. [Google Scholar]"
You are becoming older as far as 50% death in 5 years is predictable with 100% efficacy. Explosion of cancer and accute "oldering" and unrepairable DNA damage "DNA holocaust" yet proof. Justice Departments and tribunals are prepared? Pfizer-Biontech, Moderna etc.,COVAX, GAVI as whole and other 14 vaccines producents have serious problem. People don´t asleep!
Shocking Research what mRNA SpikeProtein inflicts to your body, DNA, NHEJ reparation and "oldering":
" MDPI - Viruses
https://www.mdpi.com/1999-4915/13/10/2056/htm
https://www.naturalnews.com/files/viruses-13-02056-v2.pdf
Open AccessArticle
SARS–CoV–2 Spike Impairs DNA Damage Repair and Inhibits V(D)J Recombination In Vitro
by Hui Jiang
1,2,* and Ya-Fang Mei
2,*
1
Department of Molecular Biosciences, The Wenner–Gren Institute, Stockholm University, SE-10691 Stockholm, Sweden
2
Department of Clinical Microbiology, Virology, Umeå University, SE-90185 Umeå, Sweden
*
Authors to whom correspondence should be addressed.
Academic Editor: Oliver Schildgen
Viruses 2021, 13(10), 2056; https://doi.org/10.3390/v13102056
Received: 20 August 2021 / Revised: 8 September 2021 / Accepted: 8 October 2021 / Published: 13 October 2021
This article belongs to the Special Issue SARS-CoV-2 Host Cell Interactions
Abstract
Severe acute respiratory syndrome coronavirus 2 (SARS–CoV–2) has led to the coronavirus disease 2019 (COVID–19) pandemic, severely affecting public health and the global economy. Adaptive immunity plays a crucial role in fighting against SARS–CoV–2 infection and directly influences the clinical outcomes of patients. Clinical studies have indicated that patients with severe COVID–19 exhibit delayed and weak adaptive immune responses; however, the mechanism by which SARS–CoV–2 impedes adaptive immunity remains unclear. Here, by using an in vitro cell line, we report that the SARS–CoV–2 spike protein significantly inhibits DNA damage repair, which is required for effective V(D)J recombination in adaptive immunity. Mechanistically, we found that the spike protein localizes in the nucleus and inhibits DNA damage repair by impeding key DNA repair protein BRCA1 and 53BP1 recruitment to the damage site. Our findings reveal a potential molecular mechanism by which the spike protein might impede adaptive immunity and underscore the potential side effects of full-length spike-based vaccines.
Keywords: SARS–CoV–2; spike; DNA damage repair; V(D)J recombination; vaccine
1. Introduction
Severe acute respiratory syndrome coronavirus 2 (SARS–CoV–2) is responsible for the ongoing coronavirus disease 2019 (COVID–19) pandemic that has resulted in more than 2.3 million deaths. SARS–CoV–2 is an enveloped single positive–sense RNA virus that consists of structural and non–structural proteins [1]. After infection, these viral proteins hijack and dysregulate the host cellular machinery to replicate, assemble, and spread progeny viruses [2]. Recent clinical studies have shown that SARS–CoV–2 infection extraordinarily affects lymphocyte number and function [3,4,5,6]. Compared with mild and moderate survivors, patients with severe COVID–19 manifest a significantly lower number of total T cells, helper T cells, and suppressor T cells [3,4]. Additionally, COVID–19 delays IgG and IgM levels after symptom onset [5,6]. Collectively, these clinical observations suggest that SARS–CoV–2 affects the adaptive immune system. However, the mechanism by which SARS–CoV–2 suppresses adaptive immunity remains unclear.
As two critical host surveillance systems, the immune and DNA repair systems are the primary systems that higher organisms rely on for defense against diverse threats and tissue homeostasis. Emerging evidence indicates that these two systems are interdependent, especially during lymphocyte development and maturation [7]. As one of the major double-strand DNA break (DSB) repair pathways, non-homologous end joining (NHEJ) repair plays a critical role in lymphocyte–specific recombination–activating gene endonuclease (RAG) –mediated V(D)J recombination, which results in a highly diverse repertoire of antibodies in B cell and T cell receptors (TCRs) in T cells [8]. For example, loss of function of key DNA repair proteins such as ATM, DNA–PKcs, 53BP1, et al., leads to defects in the NHEJ repair which inhibit the production of functional B and T cells, leading to immunodeficiency [7,9,10,11]. In contrast, viral infection usually induces DNA damage via different mechanisms, such as inducing reactive oxygen species (ROS) production and host cell replication stress [12,13,14]. If DNA damage cannot be properly repaired, it will contribute to the amplification of viral infection-induced pathology. Therefore, we aimed to investigate whether SARS–CoV–2 proteins hijack the DNA damage repair system, thereby affecting adaptive immunity in vitro.
2. Materials and Methods
2.1. Antibodies and Reagents
DAPI (Cat #MBD0015), doxorubicin (Cat #D1515), H2O2 (Cat #H1009), and ß-tubulin antibodies (Cat #T4026) were purchased from Sigma-Aldrich. Antibodies against His tag (Cat #12698), H2A (Cat #12349), H2A.X (Cat #7631), ?–H2A.X (Cat #2577), Ku80 (Cat # 2753), and Rad51(Cat #8875) were purchased from Cell Signaling Technology (Danvers, MA, USA). 53BP1(Cat #NB100-304) and RNF168 (Cat #H00165918–M01) antibodies were obtained from Novus Biologicals (Novus Biologicals, Littleton, CO, USA). Lamin B (Cat #sc–374015), ATM (Cat #sc–135663), DNA–PK (Cat #sc–5282), and BRCA1(Cat #sc–28383) antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). XRCC4 (Cat #PA5–82264) antibody was purchased from Thermo Fisher Scientific (Waltham, MA, USA).
2.2. Plasmids
pHPRT–DRGFP and pCBASceI were kindly gifted by Maria Jasin (Addgene plasmids #26476 and #26477) [15]. pimEJ5GFP was a gift from Jeremy Stark (Addgene plasmid #44026) [16]. The NSP1, NSP9, NSP13, NSP14, NSP16, spike, and nucleocapsid proteins were first synthesized with codon optimization and then cloned into a mammalian expression vector pUC57 with a C–terminal 6xHis tag. A 12–spacer RSS–GFP inverted complementary sequence–a 23–spacer RSS was synthesized for the V(D)J reporter vector. Then, the sequence was cloned into the pBabe–IRES–mRFP vector to generate the pBabe–12RSS–GFPi–23RSS–IRES–mRFP reporter vector. 12–spacer RSS sequence: 5'–CACAGTGCTACAGACTGGAACAAAAACC–3'. 23–spacer RSS sequence: 5'–CACAGTGGTAGTACTCCACTGTCTGGCTGTACAAAAACC–3'. RAG1 and RAG2 expression constructs were generously gifted by Martin Gellert (Addgene plasmid #13328 and #13329) [17].
2.3. Cells and Cell Culture
HEK293T and HEK293 cells obtained from the American Type Culture Collection (ATCC) were cultured under 5% CO2 at 37 °C in Dulbecco’s modified Eagle’s medium (DMEM, high glucose, GlutaMAX) (Life Technologies, Carlsbad, CA, USA) containing 10% (v/v) fetal calf serum (FCS, Gibco), 1% (v/v) penicillin (100 IU/mL), and streptomycin (100?µg/mL). HEK293T–DR–GFP and HEK293T–EJ5–GFP reporter cells were generated as previously described and cultured under 5% CO2 at 37 °C in the above-mentioned culture medium.
2.4. HR and NHEJ Reporter Assays
HR and NHEJ repair in HEK293T cells were measured as described previously using DR–GFP and EJ5–GFP stable cells. Briefly, 0.5 × 106 HEK293T stable reporter cells were seeded in 6–well plates and transfected with 2 µg I–SceI expression plasmid (pCBASceI) together with SARS–CoV–2 proteins expression plasmids. Forty–eight hours post–transfection and aspirin treatment, cells were harvested and analyzed by flow cytometry analysis for GFP expression. The means were obtained from three independent experiments.
2.5. Cellular Fractionation and Immunoblotting
For the cellular fraction assay, the Subcellular Protein Fractionation Kit (Thermo Fisher) was used according to the manufacturer’s instructions. Protein lysates were quantified using the BCA reagent (Thermo Fisher Scientific, Rockford, IL, USA). Proteins were resolved by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE), transferred to nitrocellulose membranes (Amersham protran, 0.45 µm NC), and immunoblotted with specific primary antibodies followed by HRP–conjugated secondary antibodies. Protein bands were detected using SuperSignal West Pico or Femto Chemiluminescence kit (Thermo Fisher Scientific).
2.6. Comet Assay
Cells were treated with different DNA damage reagents and then harvested at the indicated time points for analysis. Cells (1 × 105 cells/mL in cold phosphate-buffered saline [PBS]) were resuspended in 1% low–melting agarose at 40 °C at a ratio of 1:3 vol/vol and pipetted onto a CometSlide. Slides were then immersed in prechilled lysis buffer (1.2 M NaCl, 100 mM EDTA, 0.1% sodium lauryl sarcosinate, 0.26 M NaOH pH > 13) for overnight (18–20 h) lysis at 4 °C in the dark. Slides were then carefully removed and submerged in rinse buffer (0.03 M NaOH and 2 mM EDTA, pH > 12) at room temperature (RT) for 20 min in the dark. This washing step was repeated twice. The slides were transferred to a horizontal electrophoresis chamber containing rinse buffer and separated for 25 min at a voltage of 0.6 V/cm. Finally, the slides were washed with distilled water, stained with 10 µg/mL propidium iodide, and analyzed by fluorescence microscopy. Twenty fields with approximately 100 cells in each sample were evaluated and quantified using the Fiji software to determine the tail length (tail moment).
2.7. Immunofluorescence
Cells were seeded on glass coverslips in a 12–well plate and transfected with the indicated plasmid for 24 h. Then, the cells were treated with or without DNA damage reagents according to the experimental setup. The cells were fixed in 4% paraformaldehyde (PFA) in PBS for 20 min at RT and then permeabilized in 0.5% Triton X–100 for 10 min. Slides were blocked in 5% normal goat serum (NGS) and incubated with primary antibodies diluted in 1% NGS overnight at 4 °C. Samples were then incubated with the indicated secondary antibodies labeled with Alexa Fluor 488 or 555 (Invitrogen) diluted in 1% NGS at RT for 1 h. Thereafter, they were stained with DAPI for 15 min at RT. Coverslips were mounted using Dako Fluorescence Mounting Medium (Agilent) and imaged using a Nikon confocal microscope (Eclipse C1 Plus). All scoring was performed under blinded conditions.
2.8. Analysis of V(D)J Recombination
Briefly, V(D)J reporter plasmid contains inverted-GFP and IRES driving continuously expressed RFP. Continuously expressed RFP is the internal transfection control. After Recombination activation gene1/2 (RAG1/2) co–transfected into the cells, RAG1/2 will cut the RSS and mediated induction of DSBs, if V(D)J recombination occurs, the inverted GFPs are ligated in positive order by NHEJ repair. Then the cell will express functional GFP. So, the GFP and RFP double positive cells are the readout of the V(D)J reporter assay [18]. 293T cells at 70% confluency were transfected with the V(D)J GFP reporter alone (background) or in combination with RAG1 and RAG2 expression constructs, at a ratio of 1 µg V(D)J GFP reporter: 0.5 µg RAG1: 0.5 µg RAG2. The following day, the medium was changed, and after an additional 48 h, cells were harvested and analyzed by flow cytometry for GFP and RFP expression.
2.9. Statistical Analysis
All experiments were repeated at least three times using independently collected or prepared samples. Data were analyzed by Student’s t test or ANOVA followed by Tukey’s multiple-comparison tests using GraphPad 8.
3. Results
3.1. Effect of Nuclear–Localized SARS–CoV–2 Viral Proteins on DNA Damage Repair
DNA damage repair occurs mainly in the nucleus to ensure genome stability. Although SARS–CoV–2 proteins are synthesized in the cytosol [1], some viral proteins are also detectable in the nucleus, including Nsp1, Nsp5, Nsp9, Nsp13, Nsp14, and Nsp16 [19]. We investigated whether these nuclear-localized SARS–CoV–2 proteins affect the host cell DNA damage repair system. For this, we constructed these viral protein expression plasmids together with spike and nucleoprotein expression plasmids, which are generally considered cytosol–localized proteins. We confirmed their expression and localization by immunoblotting and immunofluorescence (Figure 1A and Figure S1A). Our results were consistent with those from previous studies [19]; Nsp1, Nsp5, Nsp9, Nsp13, Nsp14, and Nsp16 proteins are indeed localized in the nucleus, and nucleoproteins are mainly localized in the cytosol. Surprisingly, we found the abundance of the spike protein in the nucleus (Figure 1A). NHEJ repair and homologous recombination (HR) repair are two major DNA repair pathways that not only continuously monitor and ensure genome integrity but are also vital for adaptive immune cell functions [9]. To evaluate whether these viral proteins impede the DSB repair pathway, we examined the repair of a site-specific DSB induced by the I–SceI endonuclease using the direct repeat–green fluorescence protein (DR–GFP) and the total-NHEJ-GFP (EJ5–GFP) reporter systems for HR and NHEJ, respectively [15,16]. Overexpression of Nsp1, Nsp5, Nsp13, Nsp14, and spike proteins diminished the efficiencies of both HR and NHEJ repair (Figure 1B–E and Figure S2A,B). Moreover, we also found that Nsp1, Nsp5, Nsp13, and Nsp14 overexpression dramatically suppressed proliferation compared with other studied proteins (Figure S3A,B). Therefore, the inhibitory effect of Nsp1, Nsp5, Nsp13, and Nsp14 on DNA damage repair may be due to secondary effects, such as growth arrest and cell death. Interestingly, overexpressed spike protein did not affect cell morphology or proliferation but significantly suppressed both HR and NHEJ repair (Figure 1B–E, Figures S2A,B and S3A,B).
3.2. SARS–CoV–2 Spike Protein Inhibits DNA Damage Repair
Because spike proteins are critical for mediating viral entry into host cells and are the focus of most vaccine strategies [20,21], we further investigated the role of spike proteins in DNA damage repair and its associated V(D)J recombination. Spike proteins are usually thought to be synthesized on the rough endoplasmic reticulum (ER) [1]. After posttranslational modifications such as glycosylation, spike proteins traffic via the cellular membrane apparatus together with other viral proteins to form the mature virion [1]. Spike protein contains two major subunits, S1 and S2, as well as several functional domains or repeats [22] (Figure 2A). In the native state, spike proteins exist as inactive full–length proteins. During viral infection, host cell proteases such as furin protease activate the S protein by cleaving it into S1 and S2 subunits, which is necessary for viral entry into the target cell [23]. We further explored different subunits of the spike protein to elucidate the functional features required for DNA repair inhibition. Only the full–length spike protein strongly inhibited both NHEJ and HR repair (Figure 2B–E and Figure S4A,B). Next, we sought to determine whether the spike protein directly contributes to genomic instability by inhibiting DSB repair. We monitored the levels of DSBs using comet assays. Following different DNA damage treatments, such as ?–irradiation, doxorubicin treatment, and H2O2 treatment, there is less repair in the presence of the spike protein (Figure 2F,G). Together, these data demonstrate that the spike protein directly affects DNA repair in the nucleus.
3.3. Spike Proteins Impede the Recruitment of DNA Damage Repair Checkpoint Proteins
To confirm the existence of spike protein in the nucleus, we performed subcellular fraction analysis and found that spike proteins are not only enriched in the cellular membrane fraction but are also abundant in the nuclear fraction, with detectable expression even in the chromatin–bound fraction (Figure 3A). We also observed that the spike has three different forms, the higher band is a highly glycosylated spike, the middle one is a full–length spike, and the lower one is a cleaved spike subunit. Consistent with the comet assay, we also found the upregulation of the DNA damage marker, ?–H2A.X, in spike protein–overexpressed cells under DNA damage conditions (Figure 3B). A recent study suggested that spike proteins induce ER stress and ER–associated protein degradation [24]. To exclude the possibility that the spike protein inhibits DNA repair by promoting DNA repair protein degradation, we checked the expression of some essential DNA repair proteins in NHEJ and HR repair pathways and found that these DNA repair proteins were stable after spike protein overexpression (Figure 3C). To determine how the spike protein inhibits both NHEJ and HR repair pathways, we analyzed the recruitment of BRCA1 and 53BP1, which are the key checkpoint proteins for HR and NHEJ repair, respectively. We found that the spike protein markedly inhibited both BRCA1 and 53BP1 foci formation (Figure 3D–G). Together, these data show that the SARS–CoV–2 full–length spike protein inhibits DNA damage repair by hindering DNA repair protein recruitment.
3.4. Spike Protein Impairs V(D)J Recombination In vitro
DNA damage repair, especially NHEJ repair, is essential for V(D)J recombination, which lies at the core of B and T cell immunity [9]. To date, many approved SARS–CoV–2 vaccines, such as mRNA vaccines and adenovirus–COVID–19 vaccines, have been developed based on the full–length spike protein [25]. Although it is debatable whether SARS–CoV–2 directly infects lymphocyte precursors [26,27], some reports have shown that infected cells secrete exosomes that can deliver SARS–CoV–2 RNA or protein to target cells [28,29]. We further tested whether the spike protein reduced NHEJ–mediated V(D)J recombination. For this, we designed an in vitro V(D)J recombination reporter system according to a previous study [18] (Figure S5). Compared with the empty vector, spike protein overexpression inhibited RAG–mediated V(D)J recombination in this in vitro reporter system (Figure 4).
4. Discussion
Our findings provide evidence of the spike protein hijacking the DNA damage repair machinery and adaptive immune machinery in vitro. We propose a potential mechanism by which spike proteins may impair adaptive immunity by inhibiting DNA damage repair. Although no evidence has been published that SARS–CoV–2 can infect thymocytes or bone marrow lymphoid cells, our in vitro V(D)J reporter assay shows that the spike protein intensely impeded V(D)J recombination. Consistent with our results, clinical observations also show that the risk of severe illness or death with COVID–19 increases with age, especially older adults who are at the highest risk [22]. This may be because SARS–CoV–2 spike proteins can weaken the DNA repair system of older people and consequently impede V(D)J recombination and adaptive immunity. In contrast, our data provide valuable details on the involvement of spike protein subunits in DNA damage repair, indicating that full–length spike–based vaccines may inhibit the recombination of V(D)J in B cells, which is also consistent with a recent study that a full–length spike–based vaccine induced lower antibody titers compared to the RBD–based vaccine [28]. This suggests that the use of antigenic epitopes of the spike as a SARS–CoV–2 vaccine might be safer and more efficacious than the full–length spike. Taken together, we identified one of the potentially important mechanisms of SARS–CoV–2 suppression of the host adaptive immune machinery. Furthermore, our findings also imply a potential side effect of the full–length spike–based vaccine. This work will improve the understanding of COVID–19 pathogenesis and provide new strategies for designing more efficient and safer vaccines.
Supplementary Materials
The following are available online at https://www.mdpi.com/article/10.3390/v13102056/s1, Figure S1: Expression of nuclear–localized SARS–CoV–2 proteins in human cells, Figure S2: Effect of nuclear SARS–CoV–2 proteins on NHEJ– and HR–DNA repair pathway, Figure S3: Nsp1, Nsp5, Nsp13, Nsp14 but not spike inhibit cell proliferation, Figure S4: Effect of SARS–CoV–2 spike mutants on NHEJ– and HR– DNA repair pathway, Figure S5: In vitro V(D)J recombination assay.
Author Contributions
H.J. conceived and designed the study. H.J. and Y.-F.M. supervised the study, performed experiments, and interpreted the data. Writing—original draft preparation, H.J.; Writing—review and editing, H.J. and Y.-F.M.; funding acquisition, Y.-F.M. All authors have read and agreed to the published version of the manuscript.
Funding
This work was supported by Umeå University, Medical Faculty’s Planning grants for COVID–19 (research project number: 3453 16032 to Y.F.M.); the Lion’s Cancer Research Foundation at Umeå University (grants: LP 17–2153, AMP 19–982, and LP 20–2256 to Y.F.M.), and the base unit’s ALF funds for research at academic healthcare units and university healthcare units in the northern healthcare region (ALF–Basenheten: 2019, 2020, 2021 to Y.F.M.).
Institutional Review Board Statement
Not applicable, because of this study not involving humans or animals.
Informed Consent Statement
Not applicable, because of this study not involving humans.
Data Availability Statement
The data presented in this study are available in the main text and Supplementary Materials.
Conflicts of Interest
The authors have declared that no competing interests exist. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
V’Kovski, P.; Kratzel, A.; Steiner, S.; Stalder, H.; Thiel, V. Coronavirus biology and replication: Implications for SARS-CoV-2. Nat. Rev. Microbiol. 2021, 19, 155–170. [Google Scholar] [CrossRef]
Suryawanshi, R.K.; Koganti, R.; Agelidis, A.; Patil, C.D.; Shukla, D. Dysregulation of Cell Signaling by SARS-CoV-2. Trends Microbiol. 2021, 29, 224–237. [Google Scholar] [CrossRef]
Qin, C.; Zhou, L.; Hu, Z.; Zhang, S.; Yang, S.; Tao, Y.; Xie, C.; Ma, K.; Shang, K.; Wang, W.; et al. Dysregulation of Immune Response in Patients With Coronavirus 2019 (COVID-19) in Wuhan, China. Clin. Infect. Dis. 2020, 71, 762–768. [Google Scholar] [CrossRef] [PubMed]
Wang, F.; Nie, J.; Wang, H.; Zhao, Q.; Xiong, Y.; Deng, L.; Song, S.; Ma, Z.; Mo, P.; Zhang, Y. Characteristics of Peripheral Lymphocyte Subset Alteration in COVID-19 Pneumonia. J. Infect. Dis. 2020, 221, 1762–1769. [Google Scholar] [CrossRef] [PubMed]
Zhang, G.; Nie, S.; Zhang, Z.; Zhang, Z. Longitudinal Change of Severe Acute Respiratory Syndrome Coronavirus 2 Antibodies in Patients with Coronavirus Disease 2019. J. Infect. Dis. 2020, 222, 183–188. [Google Scholar] [CrossRef] [PubMed]
Long, Q.X.; Liu, B.Z.; Deng, H.J.; Wu, G.C.; Deng, K.; Chen, Y.K.; Liao, P.; Qiu, J.F.; Lin, Y.; Cai, X.F.; et al. Antibody responses to SARS-CoV-2 in patients with COVID-19. Nat. Med. 2020, 26, 845–848. [Google Scholar] [CrossRef]
Bednarski, J.J.; Sleckman, B.P. Lymphocyte development: Integration of DNA damage response signaling. Adv. Immunol. 2012, 116, 175–204. [Google Scholar] [PubMed]
Malu, S.; Malshetty, V.; Francis, D.; Cortes, P. Role of non-homologous end joining in V(D)J recombination. Immunol. Res. 2012, 54, 233–246. [Google Scholar] [CrossRef]
Bednarski, J.J.; Sleckman, B.P. At the intersection of DNA damage and immune responses. Nat. Rev. Immunol. 2019, 19, 231–242. [Google Scholar] [CrossRef]
Gapud, E.J.; Sleckman, B.P. Unique and redundant functions of ATM and DNA-PKcs during V(D)J recombination. Cell. Cycle 2011, 10, 1928–1935. [Google Scholar] [CrossRef]
Difilippantonio, S.; Gapud, E.; Wong, N.; Huang, C.Y.; Mahowald, G.; Chen, H.T.; Kruhlak, M.J.; Callen, E.; Livak, F.; Nussenzweig, M.C.; et al. 53BP1 facilitates long-range DNA end-joining during V(D)J recombination. Nature 2008, 456, 529–533. [Google Scholar] [CrossRef] [PubMed]
Schwarz, K.B. Oxidative stress during viral infection: A review. Free Radic. Biol. Med. 1996, 21, 641–649. [Google Scholar] [CrossRef]
Xu, L.H.; Huang, M.; Fang, S.G.; Liu, D.X. Coronavirus infection induces DNA replication stress partly through interaction of its nonstructural protein 13 with the p125 subunit of DNA polymerase delta. J. Biol. Chem. 2011, 286, 39546–39559. [Google Scholar] [CrossRef] [PubMed]
Delgado-Roche, L.; Mesta, F. Oxidative Stress as Key Player in Severe Acute Respiratory Syndrome Coronavirus (SARS-CoV) Infection. Arch. Med. Res. 2020, 51, 384–387. [Google Scholar] [CrossRef] [PubMed]
Pierce, A.J.; Hu, P.; Han, M.; Ellis, N.; Jasin, M. Ku DNA end-binding protein modulates homologous repair of double-strand breaks in mammalian cells. Genes Dev. 2001, 15, 3237–3242. [Google Scholar] [CrossRef]
Bennardo, N.; Cheng, A.; Huang, N.; Stark, J.M. Alternative-NHEJ is a mechanistically distinct pathway of mammalian chromosome break repair. PLoS Genet. 2008, 4, e1000110. [Google Scholar] [CrossRef]
Sadofsky, M.J.; Hesse, J.E.; McBlane, J.F.; Gellert, M. Expression and V(D)J recombination activity of mutated RAG-1 proteins. Nucleic Acids Res. 1993, 21, 5644–5650. [Google Scholar] [CrossRef]
Trancoso, I.; Bonnet, M.; Gardner, R.; Carneiro, J.; Barreto, V.; Demengeot, J.; Sarmento, L. A Novel Quantitative Fluorescent Reporter Assay for RAG Targets and RAG Activity. Front. Immunol. 2013, 4, 110. [Google Scholar] [CrossRef]
Zhang, J.; Cruz-cosme, R.; Zhuang, M.-W.; Liu, D.; Liu, Y.; Teng, S.; Wang, P.-H.; Tang, Q. A systemic and molecular study of subcellular localization of SARS-CoV-2 proteins. Signal Transduct. Target. Ther. 2020, 5, 269. [Google Scholar] [CrossRef]
Shang, J.; Wan, Y.; Luo, C.; Ye, G.; Geng, Q.; Auerbach, A.; Li, F. Cell entry mechanisms of SARS-CoV-2. Proc. Natl. Acad. Sci. USA 2020, 117, 11727–11734. [Google Scholar] [CrossRef]
Du, L.; He, Y.; Zhou, Y.; Liu, S.; Zheng, B.J.; Jiang, S. The spike protein of SARS-CoV—A target for vaccine and therapeutic development. Nat. Rev. Microbiol. 2009, 7, 226–236. [Google Scholar] [CrossRef] [PubMed]
Huang, Y.; Yang, C.; Xu, X.F.; Xu, W.; Liu, S.W. Structural and functional properties of SARS-CoV-2 spike protein: Potential antivirus drug development for COVID-19. Acta Pharmacol. Sin. 2020, 41, 1141–1149. [Google Scholar] [CrossRef] [PubMed]
Hoffmann, M.; Kleine-Weber, H.; Schroeder, S.; Kruger, N.; Herrler, T.; Erichsen, S.; Schiergens, T.S.; Herrler, G.; Wu, N.H.; Nitsche, A.; et al. SARS-CoV-2 Cell Entry Depends on ACE2 and TMPRSS2 and Is Blocked by a Clinically Proven Protease Inhibitor. Cell 2020, 181, 271–280.e8. [Google Scholar] [CrossRef]
Hsu, A.C.-Y.; Wang, G.; Reid, A.T.; Veerati, P.C.; Pathinayake, P.S.; Daly, K.; Mayall, J.R.; Hansbro, P.M.; Horvat, J.C.; Wang, F.; et al. SARS-CoV-2 Spike protein promotes hyper-inflammatory response that can be ameliorated by Spike-antagonistic peptide and FDA-approved ER stress and MAP kinase inhibitors in vitro. bioRxiv 2020, 2020, 317818. [Google Scholar]
Poland, G.A.; Ovsyannikova, I.G.; Kennedy, R.B. SARS-CoV-2 immunity: Review and applications to phase 3 vaccine candidates. Lancet 2020, 396, 1595–1606. [Google Scholar] [CrossRef]
Davanzo, G.G.; Codo, A.C.; Brunetti, N.S.; Boldrini, V.; Knittel, T.L.; Monterio, L.B.; de Moraes, D.; Ferrari, A.J.R.; de Souza, G.F.; Muraro, S.P.; et al. SARS-CoV-2 Uses CD4 to Infect T Helper Lymphocytes. medRxiv 2020, 2020, 20200329. [Google Scholar]
Borsa, M.; Mazet, J.M. Attacking the defence: SARS-CoV-2 can infect immune cells. Nat. Rev. Immunol. 2020, 20, 592. [Google Scholar] [CrossRef]
Barberis, E.; Vanella, V.V.; Falasca, M.; Caneapero, V.; Cappellano, G.; Raineri, D.; Ghirimoldi, M.; De Giorgis, V.; Puricelli, C.; Vaschetto, R.; et al. Circulating Exosomes Are Strongly Involved in SARS-CoV-2 Infection. Front. Mol. Biosci. 2021, 8, 632290. [Google Scholar] [CrossRef]
Sur, S.; Khatun, M.; Steele, R.; Isbell, T.S.; Ray, R.; Ray, R.B. Exosomes from COVID-19 patients carry tenascin-C and fibrinogen-ß in triggering inflammatory signals in distant organ cells. bioRxiv 2021, 2021, 430369. [Google Scholar]"
You are becoming older as far as 50% death in 5 years is predictable with 100% efficacy. Exlosion of cancer and accute "oldering" and unrepairable DNA damage "DNA holocaust" s yet proof. Justice Departments and tribunals are prepared? Pfizer-Biontech, Moderna etc.,COVAX, GAVI as whole and other 14 vaccines producents have serious problem. People don´t asleep!
800% gain on PDSB is my "personal green deal", very thankfull for that and watch the train to pickup on Downside Valley. NOT UN Organisation NEW WORLD ORDER CREATED throw billion of billions from taxpayers. Its time to make BIG RESET OF CHAZARIANS, THE NULL SOLUTION.
And why not "if we can see $5" ???
Getting the Novavax trajectory should be good prepared, everythings has a technical limits. After eruption may be established 3-6 month Sleep and bigger eruption want to follow, three times RSI 30-90-30 and we are at $390. How the VANGA said: "Cancer is going to chain down (with Versamune etc) at the beginning of 21. century."
Just for my BIG SMILE, I WAS THE FIRST !!!
Go to the history and You will find a prove my words.
I don´t think so.
1, Who will torpedo his own COVAX holocaust AND CASHCOW flagship???
2, Why will be Gates buying RVVTF, the DRUG what can end his COVID-19 chinese TOTALITY?
3, Why to destruct "THE COVID-19 worldwide KONZENTRAZIONLAGER" IF IT WORKS PROPERLY??? GREEN COVID PASSPORTS - "SIGN OF THE BEAST"
BE CLEVER AND THINK ABOUT IT, BUCILLAMINE IS A HOPE FOR FREEDOM, FOR ALL MANKIND AGAINST GLOBALISATION AND AI TOTALITY!!!
22 trading days to PHASE III Bucillamine Covid-19 treatment output and FDA approval on 1-th. May 2021, the study will complete go public at 1-th. August 2021.
Bucillamine is a first drug with 95% efficacy to threat the Covid-19 virus and will be used worldwide.
The facts:
1, 2 weeks mortality after vaccination 5% of people, 35% seniors mortality within the age 70-90+, 98% of mortality within 4 years
2, AstraZeneca vaccine, now renamed Vaxzevria, inflicts 2 weeks mortality after vaccination 10% of people, 55-60% seniors mortality within the age 70-90+, 100% of mortality within 4 years
3, BILL GATES and GAVI, COVAX : "...If we make very good job, we will reduce population around 10-15% yearly, if we make very good job!...."
What contains the vaccine?
1, Mercury
2, TitaniumDioxide
3, AluminiumSulphide
4, MRC5 - abruptly killed embrya´s DNA
5, adenovirus vector with mRNA CRISPER DNA scissors
6, PROFUSA NANOBOTS AND BIOSENSORS
7, Hydrogels and Lipide package
AstraZeneca post vaccination embolia, trombose and infarctus miocardi are caused with PROFUSA NANOBOTS AND BIOSENSORS malfunction, they can make this on remote command in 5 minutes, but in this case as a malfunction without a remote command.
Com on boars! I´m buying all your GEMS, everything, what I can. Can you tell me boars the SWEET MYSTERY, how you will cover if I sell $1.50 per Share RVVTF for March 2021? You have yet significant obstacle in delivery of borrowed shares and significant deliquency too.
Let fall this short boars into big trap on RVVTF, they will be smashed with Archangels soon! Boars are swallowing their own blood, Volcano will explode soon. 13 events in 3 month are coming into Doorside, how smell the empty accounts with no mercy?
You don´t understand the joke? If you know the Columbos story, he told about her fast 30 years from the beginning of serial, but nobody has seen her. Columbo said: " My wife does it..., cooks it..., thinks about... so mysterious behind the courtain.
You will be lucky to recognize your own portfolio, make the order and buy what has to be bought before train will take off!
Look on TA only, everything is confirmed. TRIX 15,9 a little bit under zero line, clued near under zero, it means very big explosion is on the table, supernova explosion is ticking in the core, time is hurry up to fulfill the Destiny.
1, tsar bomb = Bucillamine
2, psychedelic Psilocybin = an accelerated Supernova
See you later at $20 !
What??? Did you see the inspector Columbo´s wife on your own eyes??? Hahaha!
The Life teaches everyone: Never give up!
You may regret this decision with a breaking teeth mouth and cry for a months, "Good luck!!!" may be shown as a very decisive!
Do you think so? I have bought some blocks for my cat, she is very interested for STOCKMARKET and is playing hard with these 11 Mio overburned shortballs! Try to take the coins of cat, you can´t, she is holding the money firmly!
Special thank for upside 100-bagger and now go down back to $5 as usually to imprint another 70-bagger, if you multiply 100*70 its 7000-bagger bothsided! WOW!!! Too much Baggies are dancing around as a little chaun, but they are not HEROES!!! Will somebody remember it in the near future of three years or will be GME forgotten as DRYS???