Monday, March 07, 2016 5:21:06 PM
Excellent DD:
Post 13649.
The HER2/neu vaccines that had been tested in the past either do not stimulate sufficient cytotoxic T-cell response on the Class I pathway or they do not give a long-lasting effect, resulting in short-lived peptide specific memory. TPIV 10 mer (p373-382) beat GALE 9 mere (369-377) in clinical efficacy. TPIV is expected to begin testing it’s HER2/neu vaccine in Phase II in 2016. It's a competition based market and TPIV covers more of it.
There are two requirements needed to create a good immune response:
1) Class 1 pathway: stimulate the cytotoxic lymphocyte, CD8 (killer T-cells) that will infiltrate and destroy tumor cells, and -- PRECLINICAL TESTING
2) Class 2 pathway: stimulate the pathway that stimulates the CD4 (T helper cells) for a prolonged immune response. -- TESTED in PHASE I -- TPIV-100
In 2016, HER2-neu which will combine the two licensed technology (Phase I TPIV-100 Class II antigen (4 epitopes) + the new Class I epitopes (p373–382) into a Phase II. Clinical testing show that the newest technology allows for epitopes spreading.
Quote:
TPIV-100 Class II antigen
Phase I Clinical Trials on HER2/neu Antigens to Start at Mayo Clinic
TapImmune Inc. (OTCBB: TPIV) has announced that following recent IRB approval a Phase I Clinical Trial on a novel set of HER2/neu Class II antigens will start at Mayo Clinic, Rochester MN. Mayo Clinic received IND allowance from the FDA for this trial in 2011. TapImmune is sponsoring the Phase I study and has an Exclusive Option to License the antigen technology at the end of Phase I. Following an overwhelming response from breast cancer patients wishing to be part of this trial, Mayo anticipates the initial patient recruitment to be fully subscribed. The study will have an interim safety analysis that will examine safety after 5 patients have been enrolled and received a single cycle of treatments.
These proprietary antigens were discovered by Keith Knutson Ph.D. and colleagues using a series of computer based predictions followed by testing of breast cancer patient responses to the predicted target peptides. Importantly this immune response data indicates that these antigens are naturally processed and that tolerance to these self-antigens is not a limiting factor. The peptides show high affinity binding to human MHC proteins for 84% of the population, making this potentially applicable to a wider spectrum of patients when compared to other HER-2/neu vaccine compositions. The next Phase trial will be carried out in breast cancer patients who finished standard Herceptin®- based therapy and are at a high risk of disease recurrence. The primary endpoints of the study will be safety and immunogenicity.
This study represents the first step in the clinical development of TapImmune’s HER-2/neu vaccine program, with follow on studies adding TAP expression and additional class I target peptides in a ‘prime and boost’ approach being the ultimate goal. It is, therefore, a major milestone for the Company.
Quote:
TPIV-110 Class I + Class II antigen
HER2/NEU CLINICAL TRIAL DETAILS:
Phase 1 Clinical Trial at Mayo Clinic Rochester MN
Trial Initiated June 28 2012 – Fully Enrolled & Ongoing
The current trial is on patients that have already had traditional therapies followed by a year of Herceptin.
22 breast cancer patients previously on Herceptin
Class II antigens (4 epitopes) discovered in breast cancer patients Clin. Cancer Res. (2010) 16, 825-83
6 x monthly intradermal vaccinations + GMCSF (adjuvant)
Phase I: Endpoints
Primary: Safety
Secondary: T-cell responses
Time to disease recurrence
Phase I: Analysis
Passed interim safety checkpoints
Interim analysis indicates specific T-cell responses in all patients analyzed
Data Supports Progression to Phase lb/ll
Clinical Trial Phase Ib/II (4+1) Strategy:
Class II antigens (4 epitopes [HER-neu.p59, p88, p422, p885]) from Phase l PLUS
Class I antigen (p373-382):
Superior Killer T Cell Epitope*
Naturally processed killer T-cell epitope (p373-382)
Log order increased binding to HLA-A2
Higher class I expression on human A2 cells
4-5x killing efficacy of human breast cancer cells
* Compared to E-75 (Neuvax). J. Immunol. (2013) 190, 479-488)
The desired clinical outcome of these trials will result in a vaccine conjugate that:
treats a significantly larger patient population
Up to 50% Vs 15-20% Herceptin
Is designed to KILL Tumor Cells. Herceptin does NOT.
Shows 4 to 5X Killing of Her2neu compared to Neuvax
Has combined Helpers and Killers for LONG LIVED KILLING
Quote:
Company Overview
Our Cancer Vaccines
TapImmune is a biotechnology company focusing on immunotherapy specializing in the development of innovative peptide and gene-based immunotherapeutics and vaccines for the treatment of cancer and infectious disease. The Company combines a set of proprietary technologies to improve the ability of the cellular immune system to destroy diseased cells. These are peptide antigen technologies and DNA expression technologies, PolystartTM and TAP.
To enhance shareholder value and taking into account development timelines, the Company plans to focus on advancing its clinical programs including our HER2/neu peptide antigen program and our Folate Receptor Alpha program for breast and ovarian trials into Phase II. In parallel, we plan to complete the preclinical development of our PolystartTM technology and to continue to develop the TAP-based franchise as an integral component of our prime-and-boost vaccine methodology.
The Immunotherapy Industry for Cancer
Immunotherapy has become the most rapidly growing sector in the pharmaceutical and biotech industry. The approval and success of checkpoint inhibitors Yervoy and Opdivo (Bristol Myers Squibb) and Keytruda (Merck) together with the development of CAR T-cell therapies (Juno, Kite) has provided much momentum in this sector. In addition, new evidence points to the increasing use of combination immunotherapies for the treatment of cancer. This has provided greater opportunities for the successful development of T-cell vaccines in combination with other approaches.
Products and Technology in Development
Clinical
Phase I Human Clinical Trials – HER2/neu+ Breast Cancer – Mayo Clinic
Patient dosing has been completed. Final safety analysis on all the patients treated is complete and shown to be safe. In addition, 19 out of 20 evaluable patients showed robust T-cell immune responses to the antigens in the vaccine composition providing a solid case for advancement to Phase II in 2015. An additional secondary endpoint incorporated into this Phase I Trial will be a two year follow on recording time to disease recurrence in the participating breast cancer patients.
For Phase I(b)/II studies, we plan to add a Class I peptide, licensed from the Mayo Clinic (April 16, 2012), to the four Class II peptides. Management believes that the combination of Class I and Class II HER2/neu antigens, gives us the leading HER2/neu vaccine platform. Therefore a key goal in 2015 is to progress the HER2/neu vaccine towards the above mentioned Phase 1(b)/II Clinical Trial.
Phase I Human Clinical Trials – Folate Alpha Breast and Ovarian Cancer – Mayo Clinic
Folate Receptor Alpha is expressed in over 80% of triple negative breast cancers, and in addition, over 90% of ovarian cancers, for which the only treatment options are surgery and chemotherapy, leaving a very important and urgent clinical need for a new therapeutic. Time to recurrence is relatively short for these types of cancer and survival prognosis is extremely poor after recurrence. In the United States alone, there are approximately 30,000 ovarian cancer patients and 40,000 triple negative breast cancer patients newly diagnosed every year.
A 24 patient Phase I clinical trial has been completed. The vaccine is well tolerated and safe and 20 out of 21 evaluable patients showed positive immune responses providing a strong rationale rational for progressing to phase 2 trials. GMP manufacturing for Phase II trials is underway and final analyses of clinical plans are near completion. TapImmune has now converted the exclusive license option into a full License Agreement.
Preclinical
PolystartTM
The Company has converted the previously filed U.S. Provisional Patent Application on PolystartTM into a full Patent Application, and will extend technology constructs as boost strategies for the current clinical programs in breast and ovarian cancer.
Current State of the Company
TapImmune is a clinical-stage immunotherapy company specializing in the development of innovative peptide and gene-based immunotherapeutics and vaccines for the treatment of cancer. The Company now has multiple clinical trials underway at the Mayo Clinic in Rochester, MN. In addition to our own sponsored clinical trials, a new grant-funded breast and ovarian cancer trial was started by Mayo using the same Folate Alpha Receptor peptides to which we have the exclusive commercial rights. Our development pipeline is extremely strong and provides us the opportunity to continue to expand on collaborations with leading institutions and corporations.
We continue to be focused on our entry into Phase II Triple Negative Cancer Trials including application for Fast Track & Orphan Drug Status as well as planning for Phase II HER2/neu Breast Cancer Trials.
We will also produce new PolyStartTM constructs, in-house, to facilitate collaborative efforts in our current clinical indications and those where others have already indicated interest in combination therapies.
In addition, we will continue to work on deficit reduction and capital improvement in order to make the required benchmarks for an uplisting to the NASDAQ or another major US exchange. To that end we are also anticipating the result of grant applications submitted early this year.
Together, these fundamental programs and corporate activities have positioned TapImmune extremely well to capitalize on the acceptance of immunotherapy as a leading therapeutic strategy in cancer and infectious disease resulting in exploding valuations in the market.
TapImmune’s Pipeline
The Company has a deep pipeline of potential blockbuster immunotherapies under development. Two of the clinical programs are completing Phase I studies and are expected to advance to Phase II in 2016. These are major inflection and valuation events, and we believe that, in light of these assets, the Company is significantly undervalued. Over the past year a number of highly visible transactions and billion dollar acquisitions have taken place that validate the work we are doing. We believe that, if our treatment successfully reaches commercialization, it will be applicable to 50% of the HER2/neu Breast Cancer market, which is a $21 billion annual market. Lastly, we further believe that if our Ovarian Cancer treatment reaches commercialization, it will be applicable to 95% of the market which Decision Resources, one of the world’s leading research firms for pharmaceuticals and healthcare, believes will triple in the next 10 years to at least $1.5 billion annually.
In addition to the exciting clinical developments, our peptide vaccine technology may be coupled with our recently developed in-house PolystartTM nucleic acid-based technology designed to make vaccines significantly more effective by producing four times the required peptides for the immune systems to recognize and act on. Our nucleic acid-based systems can also incorporate “TAP” which stands for Transporter associated with Antigen Presentation. Our technologies are also widely applicable to the treatment of emerging viral threats and pandemics. In particular, our highly versatile PolyStartTM technology has application in these areas. With respect to validation of our technologies, it is important to note that the majority of our technologies have been published in leading peer-reviewed journals. The timing of such publications is consistent with the filing of patents.
More specifics on the difference between p369-377 (GALE) and p373-382 (TPIV)
Quote:
J Immunol. 2013 Jan 1;190(1):479-88. doi: 10.4049/jimmunol.1201264. Epub 2012 Nov 23.
Enzymatic discovery of a HER-2/neu epitope that generates cross-reactive T cells.
Henle AM1, Erskine CL, Benson LM, Clynes R, Knutson KL.
Abstract
Patients with HER-2/neu-expressing breast cancer remain at risk for relapse following standard therapy. Vaccines targeting HER-2/neu to prevent relapse are in various phases of clinical testing. Many vaccines incorporate the HER-2/neu HLA-A2-binding peptide p369-377 (KIFGSLAFL), because it has been shown that CTLs specific for this epitope can directly kill HER-2/neu-overexpressing breast cancer cells. Thus, understanding how tumors process this epitope may be important for identifying those patients who would benefit from immunization. Proteasome preparations were used to determine if p369-377 was processed from larger HER-2/neu-derived fragments. HPLC, mass spectrometry, cytotoxicity assays, IFN-? ELISPOT, and human breast cancer cell lines were used to assess the proteolytic fragments. Processing of p369-377 was not detected by purified 20S proteasome and immunoproteasome, indicating that tumor cells may not be capable of processing this Ag from the HER-2/neu protein and presenting it in the context of HLA class I. Instead, we show that other extracellular domain HER-2/neu peptide sequences are consistently processed by the proteasomes. One of these sequences, p373-382 (SLAFLPESFD), bound HLA-A2 stronger than did p369-377. CTLs specific for p373-382 recognized both p373-382 and p369-377 complexed with HLA-A2. CTLs specific for p373-382 also killed human breast cancer cell lines at higher levels than did CTLs specific for p369-377. Conversely, CTLs specific for p369-377 recognized p373-382. Peptide p373-382 is a candidate epitope for breast cancer vaccines, as it is processed by proteasomes and binds HLA-A2.
Full article of part of TPIV new epitopes:
www.ncbi.nlm.nih.gov/pmc/articles/PMC3529812/
Enzymatic discovery of a HER-2/neu epitope that generates cross-reactive T cells
Andrea M. Henle,* Courtney L. Erskine,* Linda M. Benson,† Raphael Clynes,‡ and Keith L. Knutson*
Patients with HER-2/neu-expressing breast cancer remain at risk for relapse following standard therapy. Vaccines targeting HER-2/neu to prevent relapse are in various phases of clinical testing. Many vaccines incorporate the HER-2/neu HLA-A2 binding peptide p369–377 (KIFGSLAFL), since it has been shown that cytotoxic T lymphocytes (CTLs) specific for this epitope can directly kill HER-2/neu overexpressing breast cancer cells. Thus, understanding how tumors process this epitope may be important for identifying the patients that would benefit from immunization. Proteasome preparations were used to determine if p369–377 was processed from larger HER-2/neu derived fragments. HPLC, mass spectrometry, cytotoxicity assays, IFN-? ELIspot, and human breast cancer cell lines were used to assess the proteolytic fragments. Processing of p369–377 was not detected by purified 20S proteasome and immunoproteasome, indicating that tumor cells may not be capable of processing this antigen from the HER-2/neu protein and presenting it in the context of HLA class I. Instead, we show that other extracellular domain HER-2/neu peptide sequences are consistently processed by the proteasomes. One of these sequences, p373–382 (SLAFLPESFD), bound HLA-A2 stronger than p369–377. CTLs specific for p373–382 recognized both p373–382 and p369–377 complexed with HLA-A2. CTL specific for p373–382 also killed human breast cancer cell lines at higher levels than p369–377 specific CTL. Conversely, CTLs specific for p369–377 recognized p373–382. Peptide p373–382 is a candidate epitope for breast cancer vaccines as it is processed by proteasomes and binds HLA-A2.
Breast cancer is one of the leading causes of cancer death for women worldwide and is the leading site of cancer for females in the United States (1, 2). This year alone it is estimated that there will be approximately 226,870 new cases of invasive breast cancer and 39,510 deaths in females in the United States (1). Breast cancer is generally divided into three subtypes, estrogen receptor/progesterone receptor-positive, HER-2/neu receptor-positive, and triple negative breast cancers. Despite recent advances in therapy for primary breast tumors, relapse remains a significant concern, particularly for the HER-2/neu and triple negative subsets. Tumors that recur in these patients are often more aggressive, metastatic, chemoresistant and are the leading cause of death among women with breast cancer. Survival rates for patients with recurrent breast cancer are approximately 50% whereas the 5 year survival rate for patients with primary breast cancer is almost 90% (3).
INTRODUCTION:
Vaccines are being developed to prevent the recurrence of breast cancer. The majority of vaccines being tested in clinical trials are designed to augment the immune response against tumor antigens which are often overexpressed in breast tumors (4, 5). HER-2/neu, which is expressed in 20 to 40% of invasive breast tumors, is one antigen that is commonly targeted with vaccines (6). HER-2/neu is a transmembrane domain spanning receptor with an intracellular tyrosine kinase signaling domain. The HER2 signaling domain is activated upon heterodimerization with other members of the HER family (HER1, HER3, or HER4) or upon homo-dimerization (7, 8). Overexpression of this oncogenic protein leads to cellular transformation through increased proliferation and survival (7).
Although many different HER-2/neu vaccination strategies have been or are being investigated, vaccines formulated with synthetic cytotoxic T cell activating peptide epitopes are among the most advanced (9–13). For example, one vaccine strategy that has generated significant interest is composed of the adjuvant, GM-CSF, mixed with the HLA-A2 binding HER-2/neu extracellular domain derived peptide p369–377 (E75) (4, 5). Fisk and colleagues identified p369–377 in 1995 based on the presence of HLA-A2 anchoring motifs (14). Experiments using peptide-elicited CD8+ T cell clones or HLA-A2+ transgenic mice provided strong evidence of natural processing of p369–377 and HLA-A2 presentation (14, 15). Some controversy, however, emerged in 1998 when Zaks and Rosenberg failed to demonstrate that vaccine-elicited p369–377-specific T cells could readily recognize HLA-A2+ HER-2/neu+ tumors, casting some doubt on the utility of this epitope in eliciting therapeutic T cells (16). However, human studies by Knutson and colleagues further supported the prior studies suggesting natural presentation in HLA-A2 (17, 18).
Subsequent to this early work, Mittendorf and colleagues conducted exploratory Phase I and II clinical trials in early stage node-negative and node-positive breast cancer patients (5). In the most recent 24-month landmark analysis, Mittendorf reported summary results of those trials (4). Of 182 evaluable patients, 24-month disease free survival was 94.3% in the vaccine group and 86.8% in the control. Although not reaching statistical significance (p=0.08) when considering all evaluable patients, further analysis revealed statistically significant benefit in subsets of patients. Phase II and III clinical trials investigating p369–377 in combination with GM-CSF, with or without trastuzumab are ongoing (www.clinicaltrials.gov) to further determine clinical benefit.
Considering the potential for success of the p369–377 vaccine in preventing recurrence, our group became interested in developing biomarkers that may further enhance selection of patients that would benefit from the vaccine. Because p369–377 is displayed in the context of HLA class I, our interest in the present study focused on the role of the proteasome or immunoproteasome in processing p369–377. These proteasomes are two large multi-subunit complexes that are important for the processing of the vast majority of HLA class I presented epitopes (19). Once processed, the peptides released from the proteasomes are translocated into the endoplasmic reticulum via TAP1 and TAP2 and loaded onto class I molecules. Although p369–377 is an epitope that is empirically predicted to be processed by the proteasomes (Henle and Knutson, unpublished observation), to the best of our knowledge, no studies have specifically shown this biochemically, which was the focus of the present study. Thus, using purified human 20S proteasome and immunoproteasome, we asked whether p369–377 could be processed from longer HER-2/neu peptides, allowing it to be available for binding HLA class I molecules. Our data suggests that p369–377 is not processed by either the 20S proteasome or the immunoproteasome. However, other peptides derived from the extracellular domain of HER-2/neu were consistently processed by both enzymes. One newly identified peptide that is processed by both the immunoproteasome and proteasome is p373–382, a strong HLA-A2 binder that is able to prime CD8+ T cells for HER-2/neu+ breast tumor cell recognition and lysis.
MATERIALS AND METHODS
Cancer Cell Lines
The breast cancer cell lines SK-BR3, HCC1419, MCF7, and BT20 were purchased from the American Type Culture Collection (ATCC), immediately resuscitated and expanded in RPMI medium containing 10% FBS, and supplemented with 25 mM HEPES, 1.5 g/l sodium bicarbonate, 0.1 mM MEM nonessential amino acids, 1 mM sodium pyruvate, 2 mM l-glutamine, and 50 mM 2-ME (Invitrogen), at 37°C and 5% CO2. Prior to assays, the cell lines were incubated overnight with 500 U/ml IFN-? to ensure maximum HLA class I expression. The esophageal adenocarcinoma cell line, FLO-1, was a gift from Dr. Harry H. Yoon (Mayo Clinic, Rochester, MN). For verification, all tumor cell lines were tested for HLA-A status using a Biotest HLA-A SSP kit (Dreieich, Germany) and were tested for HER-2/neu status using RT-PCR (primer sequences: F: (GCTCTTTGAGGACAACTATGCCC) R: (GCCCTTACACATCGGAGAACAG)). Tumor cells were frozen as seeding stocks. For the assays, the cells were thawed rapidly in a 37°C water bath and expanded in RPMI medium as described above. Since HER-2/neu expression has been associated with loss of class I expression in some models (20, 21), the HLA-A2 and HER-2/neu status of each cell line were verified by flow cytometry following exposure to IFN-?, as we have previously described (22), using mouse anti-human HLA-A2 FITC and anti HER-2/neu FITC antibodies. Cognate isotypes were, respectively, mouse IgG2b,? FITC isotype and mouse IgG1,? FITC isotype (BD Pharmingen).
Peptide and Protein Synthesis
The peptides used in this study were the ovalbumin peptide (OVA), SIINFEKL; the HLA-A2 binding influenza matrix protein M1 peptide p58–66 (pFLU), GILGFVFTL; and the HER-2/neu peptides p369–377, KIFGSLAFL; p368–376, KKIFGSLAF; p372–380, GSLAFLPES; p364–373, FAGCKKIFGS; p373–382, SLAFLPESFD; p364–382, FAGCKKIFGSLAFLPESFD; and p362–384, QEFAGCKKIFGSLAFLPESFDGD. All peptides were manufactured by the Mayo Clinic Proteomics Core or Elim Biopharmaceuticals and were greater than 80% pure as assessed by HPLC and mass-spectrometric analysis. The HER-2/neu extracellular domain (ECD) was purified by trastuzumab affinity chromatography from culture supernatants of baby hamster kidney cell-produced extracellular domain as previously described by us and others (23, 24).
Prediction Algorithms
Potential HLA-A2 binding peptides from large HER-2/neu peptide sequences were predicted using a matrix pattern that calculates how peptides bind to the HLA-A2 motif based on previously published peptide motifs. The prediction algorithm is “SYFPEITHI: database for MHC ligands and peptide motifs” (25). It can be accessed via: www.syfpeithi.de.
The C-Term 3.0 and 20S prediction networks on the Netchop 3.1 Server (http://www.cbs.dtu.dk/services/NetChop/), and proteasome and immunoproteasome models 1, 2, and 3 on the Proteasome Cleavage Prediction Server (http://imed.med.ucm.es/Tools/pcps/index.html) were used to identify the cleavage of potential HLA-A2 binding peptides from large HER-2/neu peptide sequences. Results from all possible cleavage prediction methods were compiled for the study.
HLA-A2 Stabilization Assays
The lymphoblastic cell line, T2 (ATCC), was maintained at 37°C and 5% CO2 in Iscove's Modified Dulbecco's Medium (IMDM) supplemented with 20% FBS. For stabilization assessment, T2 cells were washed, counted, and resuspended at 1 × 106 cells/mL in IMDM in a 24-well plate and pulsed with a serial dilution of 0.2 – 100 µM peptide for 16 hours at room temperature. Subsequently, cells were washed 3× in PBS/0.5% BSA and stained with anti-HLA-A2 FITC antibody (clone BB7.2, BD Pharmingen) or isotype control mouse IgG2b,? FITC antibody (BD Pharmingen) and analyzed by flow cytometry on a FACScan with CellQuest software (BD Biosciences). Influenza peptide (pFLU, GILGFVFTL, (26)) served as a positive control. SIINFEKL served as the negative control peptide.
Human T Cell Isolation and Cultures
Whole blood samples obtained from Leuko Reduced Separator (LRS) Chambers (Trima) from the Department of Transfusion Medicine at Mayo Clinic were lysed in ammonium-chloride-potassium (ACK) buffer and separated over Ficoll-Paque (GE Healthcare). 1×106cells from the peripheral blood mononuclear cell (PBMC) fraction were stained with mouse anti-human HLA-A2 FITC BB7.2 antibody (BD Pharmingen) or mouse IgG2b,? FITC antibody (BD Pharmingen) and analyzed with a FACScan flow cytometer (BD Biosciences). PBMC samples which stained positive for HLA-A2 were further enriched with the CD8+ T Cell Isolation Kit II (Miltenyi Biotec) and separated by AutoMACS (Miltenyi Biotec) per the manufacturer's protocol.
Enriched CD8+ T cells were plated in 2 mL media in 6 well plates at 2×106 cells per mL. Peptide was added at a concentration of 10 µg/mL. Remaining CD8- PBMC were frozen for future restimulations. On days 3 and 5, human recombinant IL-2 was added to the wells at 50 U/mL and human recombinant IFN-? was added at 100 U/mL. On day 7, cryopreserved PBMC were thawed, washed three times, pulsed with 10 µg/mL peptide for 2 hours, and irradiated to 4000 rads. The PBMC were washed and suspended in fresh media and then added to the CD8+ T cells. One additional restimulation was done on day 14. The cells were used for assays on Days 21 through 28.
Human ELISpot
An IFN-? ELISpot (enzyme-linked immunosorbent spot) assay was performed as described previously (18). Briefly, cultured CD8+ T cells were incubated at 37°C for 48 hours with breast cancer cell lines or PBMC that had been pulsed with 100 µM peptide at 37°C and 5% CO2 for 16 hours, media alone, or PMA ionomycin. Respective wells containing target cells were, in some assays, incubated with blocking antibodies for 1 hour at a concentration of 1 µg per 100 µl RPMI + 10% FBS media prior to CD8+ T cell addition. All antibodies were from BD Pharmingen (purified mouse anti-human HLA-A2 BB7.2, purified mouse anti-human HLA-ABC W6/32, purified mouse IgG2b,? isotype control, and purified IgG2a,? isotype control).
Cytolytic T Cell Assays
Lysis of tumor cells was done using an impedance-based approach as previously described (22, 27). 100 µl of RPMI 1640 (Mediatech) with 10% FBS was added to each well in an E-Plate 16 (Roche). Background impedance on the plate was measured on the xCELLigence RTCA SP instrument (Roche) at 37°C and 5% CO2. Human tumor cell lines (SK-BR3, MCF7, BT20, FLO, and HCC1419) were harvested with trypsin, counted, washed, and resuspended in RPMI 1640 with 10% FBS and 500 U/ml human IFN-? (PeproTech) at 5 × 104 cells/ml. IFN-? was used to ensure maximal upregulation of HLA class I molecules. 100 µl of the tumor cells were added to each well of the E-Plate 16, which was then placed in the xCELLigence RTCA DP. Impedance was measured every 5 minutes for approximately 20 hours at 37°C and 5% CO2 (until the cells adhered to the gold electrodes on the bottom of each well and proliferated to approximately 1 × 104 cells/well). T cells were counted and resuspended at a concentration of 5 × 105 cells/ml in RPMI + 10% FBS media. One hundred µl of T cells or media alone were then added to the respective wells. The E-plate 16 was placed in the xCELLigence RTCA SP and impedance measurements were recorded every 5 minutes for greater than 10 additional hours at 37°C and 5% CO2. T cell mediated death of tumor cells was monitored in real time and was indicated by a decrease in cell index. Data was analyzed with RTCA Software 1.2 (Acea Biosciences). Results were normalized 1 to 2 hours after T cell addition. Cytolytic activity was calculated as the percentage of cytolysis 10 hours after the normalization time (=[CIno effector-CIeffector]/CIno effector × 100). For HLA-class I blocking, antibodies were added at a concentration of 1 µg per 100 µl RPMI + 10% FBS media.
Proteasome and Immunoproteasome Cleavage Assay, HPLC, and Mass Spectrometry
Purified human 20S proteasome, immunoproteasome, PA28 activator a subunit, and synthetic lactacystin were obtained from Boston Biochem. Proteasome and immunoproteasome enzymes were assayed for activity with the fluorescent Suc-LLVYAMC substrate (Boston Biochem) per the manufacturer's protocol. Cleavage assays were performed in 400 µl reaction buffer (25 mM HEPES, 0.5 mM EDTA, pH 7.6, Boston Biochem). PA28 activator (stock 20 µM) was added to the reaction buffer to a final concentration of 14.5 nM. Human proteasome or immunoproteasome enzymes (stock 2 µM) were added to the reaction buffer to a final concentration of 1.45 nM. 10 mM peptide substrate (HER-2/neu 19 mer or 23 mer) was diluted in the reaction mix 1:1000. Some samples had lactacystin added to the reaction to a final concentration of 10 µM to inhibit the proteasome activity. Blanks without proteasome or immunoproteasome were run in parallel. Samples were incubated in a 37°C water bath for 30–60 minutes. Preliminary studies suggested no difference in the cleavage products detected between 30 minutes and 1 hour (data not shown). Samples were then filtered using pre-washed YM-30 30,000 kDa MWCO microcon filters (Millipore) at 14,000g for 15 minutes. Filter retentates were collected by inverted centrifugation at 3,000g for 3 minutes.
Cleavage products (5 µl of the reaction mixture) from the HER-2/neu peptide incubations were separated and identified using an Agilent 1100 HPLC system interfaced to an Agilent MSD/TOF mass spectrometer. The products were resolved on an Agilent Zorbax 300SB-C18 column (1×150 mm; 3.5µ; 45°C) using mobile phases containing H2O, acetonitrile, isopropanol, and formic acid (Pump A: 98:1:1:0.1 and Pump B: 10:80:10:0.1 (v/v/v/v)). The separation gradient was 5–60%B over 23 min; 80%B for 5 min; with a 7 min equilibration at 5%B using a flow rate of 60 µL/min. Mass spectra were collected in positive mode using an Electrospray Ionization (ESI) interface over an m/z range of 300 to 2800. Other instrument parameters used were spray voltage-3500V; Fragmentor-175V; Skimmer-65V; RF Octopole-250V; gas temp-325°C; gas flow-5 L/min; and nebulizer gas-30 psi. Raw spectra were obtained and peaks transformed to molecular masses using Agilent MassHunter Qualitative Analysis with Bioconfirm software (version B.02.00). The observed masses were then compared to the theoretical masses of the known HER-2/neu peptide sequences and assigned a sequence.
Statistical Analysis
Statistical analyses were performed using GraphPad Prism 5. Data were analyzed using One-way ANOVA, Tukey's, Mann-Whitney or Student's t-tests as stated in legend, and the results were considered statistically significant if p<0.05.
The proteasome and immunoproteasome fragment synthetic HER-2/neu derived peptides into multiple shorter peptides
A 19 amino acid sequence (p364–382, FAGCKKIFGSLAFLPESF) derived from the extracellular domain of HER-2/neu was synthesized to study whether the proteasome and immunoproteasome could cleave the HLA-A2 HER-2/neu epitope, p369–377. Processing studies utilizing longer peptides are common in the cancer epitope discovery field and provide greater detection in vitro compared to cleavage assays using full length recombinant HER-2/neu protein (28–30). HER-2/neu p369–377 is embedded in the synthesized 19 mer, with an extra 5 amino acids on both the N- and C-termini.
Purified proteasome and immunoproteasome enzymes were individually incubated with the 19 mer substrate and PA28 activator. Cleaved products were analyzed via LC-MS (Fig. 1A). Several peptides between 8 to 10 amino acids in length, the appropriate length for binding to HLA class I molecules, were detected in the cleaved samples. However, p369–377 was not detected in any of the samples (Fig. 1B). These results suggest that p369–377 is not a reaction product of the proteasome or immunoproteasome.
Peptides generated in vitro by proteasomes are predicted to bind HLA-A2
Since peptides other than p369–377 were detected as degradation products, weuestioned whether any of these peptides may serve as potential candidates for HER-2/neu cancer immunotherapies. Thus, an HLA binding prediction server, SYFPEITHI, was used to predict the ability of these other peptides to bind HLA-A2 molecules (Table I). Several peptides scored higher than 10 suggesting that these epitopes may bind HLA-A2. For comparison, p369–377 had a score of 28, indicating that it is predicted to bind strongly to HLA-A2, a finding which is consistent with prior studies (5). Proteasome and immunoproteasome cleavage servers were also used to compare algorithm predictions to the in vitro results. The cleavage predictions from the algorithms did not always correspond with the in vitro biochemical data (Table I). Specifically, the algorithm predictions aligned with the in vitro cleavage data in 6 of 12 (50%) peptides (Table I).
Binding of HER-2/neu p373–382 to HLA-A2 molecules
Since the algorithms predicted that many of the degradation peptides may serve as targets which could be displayed in HLA class I on the surface of breast cancer cells, T2 HLA-A2 stabilization assays were performed. Influenza matrix protein M1 peptide was used as the positive control since it is known to bind HLA-A2 strongly and result in HLA-A2 stabilization on the surface of T2 cells. SIINFEKL was used as the negative control as it does not bind HLA-A2. Four peptides (p368–376, KKIFGSLAF; p372–380, GSLAFLPES; p364–373, FAGCKKIFGS; and p373–382, SLAFLPESFD) identified via the in vitroproteasome and immunoproteasome assays were synthesized and tested for their binding to HLA-A2. Only the p369–377 epitope and another epitope, p373–382, resulted in increased surface levels of HLA-A2, indicating that these peptides are able to bind A2 and stabilize the complex (Fig. 2A and data not shown (non-binding HER-2/neu peptides)). Titration studies with each peptide were conducted to compare the peptide affinity for HLA-A2. The p373–382 epitope bound HLA-A2 strongly, resulting in HLA-A2 stabilization at concentrations as low as 200 nM. In contrast, p369–377 did not begin to stabilize HLA-A2 until the peptide was at a concentration of ~6–7 µM (Fig. 2B). Pulsing with 50 µM of the p373–382 peptide consistently resulted in increased surface expression of the HLA-A2 molecule on T2 cells, at levels similar to the positive control pFLU peptide (Fig. 2C). The p369–377 epitope stabilized HLA-A2 at approximately 50% of the maximal stabilization seen with pFLU HLA-A2 upregulation. The concentration of peptide that induced half maximal stabilization of HLA-A2 was ~ 0.94 µM for pFLU, ~1.8 µM for p373–382, and ~9.6 µM for p369–377 (Fig. 2D).
Processing of p373–382 and other peptides from a 23 mer sequence of HER-2/neu
Although the p373–382 peptide was released from the 19 mer peptide by both the proteasome and immunoproteasome and can bind HLA-A2, the epitope was located on the C-terminal end of the 19 mer and therefore cleavage between two adjacent amino acids was not possible to measure. However, in both the proteasome and immunoproteasome samples in Fig. 1, the potential for processing of the 19 mer into the p373–382 decamer was detected by monitoring C-terminal end conversion from an amide to a free acid (not shown).
To determine if p373–382 could be internally processed, a 23 mer peptide (p362–384, QEFAGCKKIFGSLAFLPESFDGD) from HER-2/neu was synthesized. The in vitroproteasome and immunoproteasome assays were repeated with the 23 mer. Although proteolysis was generally less efficient with the longer peptide, LC-MS showed that several peptide epitopes were detected in these samples (Supplementary Fig. S1A and Supplementary Table SI). Again, the p369–377 epitope was not detected in the proteasome or the immunoproteasome samples (Supplementary Fig. S1B). Extracted ion chromatograms showed that the p373–382 decamer was processed in both the proteasome and to a lesser extent, the immunoproteasome samples (Fig. 3). Although lower levels of the decamer were detected in the lactacystin inhibited reactions compared to the uninhibited proteasome reaction, generation of p373–382 was still present, suggesting the proteasome uses both lactacystin-resistant and sensitive catalysis to liberate the peptide. Overall comparison shows that the peptide products generated by proteolysis from the 23 mer were similar to the products obtained with the 19 mer peptide (Figs. 3B and C).
Generation of HER-2/neu peptide-specific CD8+ T cells
Thus far, the results suggest that p373–382 can be processed by the proteasome and immunoproteasome and that it binds HLA-A2 strongly, suggesting potential clinical relevance. To address this, blood was obtained from human donors and short term CD8+ T cell lines were generated against pFLU, p369–377 and p373–382. IFN-? ELISpot analysis using autologous peptide-pulsed PBMC as targets demonstrated specificity of the lines (Fig. 4A). The pFLU T cell line only recognized pFLU and none of the other peptide-pulsed PBMC targets. The p369–377 pulsed PBMC were recognized by the p369–377 CD8+ T cells and, unexpectedly, also by the p373–382 T cells. Similarly, the p373–382 pulsed PBMC were recognized by the p373–382 specific CD8+ T cells but also by the p369–377 specific T cells. Thus, the results show that T cells responsive to p373–382 exist in the human T cell repertoire.
HER-2/neu p373–382 specific CTL recognize breast cancer cells and naturally processed antigen
To address whether p373–382-generated T cells recognize HER-2/neu-expressing breast cancer cells, a panel of HER-2/neu and HLA-A2-expressing breast cancer cell lines was used in an ELISpot assay with the three different T cell lines (Fig. 4B). Using IFN-? ELISpot, the activities of the lines were compared. Despite equivalency of the cell lines, in terms of numbers of specific cells, as assessed in the ELISpot using autologous targets, p373–382-generated T cells generally recognized the breast cancer cells at higher levels compared to the p369–377 specific T cells. BT20 cells served as the negative control cell line as they are HLA-A2 negative. These results indicate that cancer cells may be processing and presenting the p373–382 peptide at their surface in the context of HLA-A2. The CD8+ T cell lines were also tested for cytotoxicity. Similar to the IFN-? ELISpot results, the p373–382 T cells lysed the cancer cell lines at higher levels compared to the p369–377 T cells. The BT-20 (HLA-A2 negative) and FLO (HER-2/neu negative and HLA-A2 positive) cell lines served as negative controls (Fig. 4C).
To further demonstrate that p373–382 is a naturally processed epitope from HER-2/neu, we pulsed autologous PBMC with HER-2/neu p373–382, pFLU, HER-2/neu ECD, and ovalbumin protein and assayed for IFN-?+ ELIspot with HER-2/neu p373–382 specific CD8+ T cells and pFLU specific CD8+ T cells. CD8+ T cells specific for p373–382 had a strong response against p373–382 pulsed PBMC and against HER-2/neu ECD pulsed PBMC (Fig. 4D). The amount of nonspecific activity displayed by the T cells was minimal as control pFLU specific T cells had little recognition of targets pulsed with HER-2/neu peptide and ovalbumin, and similarly, p373–382 specific T cells recognized control ovalbumin and pFLU pulsed targets at low levels.
IFN-? and lytic responses of p373–382-generated T cells are HLA class I restricted
To address whether the IFN-? response of p373–382-generated T cells was HLA class I restricted, T cells lines were generated against all three peptides, pFLU, p369–377, and p373–382 followed by IFN-? ELISpot testing in the presence or absence of a blocking anti-HLA-class I heavy chain antibody. The pFLU T cells did not recognize p373–382-pulsed PBMC targets. As expected, both the p369–377 and p373–382-generated T cells recognized p373–382 pulsed PBMC with IFN-? release (Fig. 5A). The addition of anti-HLA class I heavy chain (Anti-HLA-ABC) antibody resulted in a significant 90% reduction in the numbers of cells responding with IFN-?. The same cell line was tested several days later replacing anti-HLA-ABC with specific anti-HLA-A2 blocking antibody. As shown in Fig. 5B, anti-HLA-A2 blocked IFN-? release to the same extent as anti-HLA-ABC, suggesting that HLA-A2 is the primary mediator of reactivity. Also shown in Figs. 5A and 5B, the number of p369–377 T cells releasing IFN-? in response to p373–382-pulsed targets decreased completely with the addition of anti-HLA-ABC and anti-HLA-A2 antibodies, further supporting cross-reactivity of the p369–377 and p373–382 T cell lines. Consistent with the ELISpot analysis, blocking of HLA class I on the surface of SKBR3 breast cancer cells nearly abolished lysis of the tumor cells by both p369–377 T cells and p373–382 T cells (Fig. 5C).
Discussion
HER-2/neu peptide p369–377 was one of the earliest tumor antigen derived cytotoxic T cell epitopes to have been identified (14). Based on the success of moving this epitope into human clinical use, we chose to determine whether this epitope is cleaved for HLA-class I presentation by the immunoproteasome or proteasome. Despite a positive prediction result with the proteasome and immunoproteasome cleavage servers, cleavage of the peptide was not detected in in vitro proteasome and immunoproteasome assays. In contrast, an HPLC co-migrating peptide, HER-2/neu p373–382, was consistently observed. This peptide was able to generate antigen-specific CD8+ CTL from the peripheral blood of HLA-A2+normal donors that effectively killed HER-2/neu-expressing tumor cells. HER-2/neu p369–377-specific CD8+ CTL were also generated from the peripheral blood of HLA-A2+normal donors using the p369–377 peptide, but these did not recognize HLA-A2+ breast cancer cells as strongly as p373–382-specific CTL. These results suggest that HER-2/neu positive cancer cells produce p373–382 via the proteasome and immunoproteasome. HER-2/neu p373–382 may be an effective candidate to induce HER-2/neu specific effector CD8+ T cell responses in vivo in patients.
HER-2/neu p369–377 was not detected in in vitro proteasome and immunoproteasome assays. Despite an abundance of prior work demonstrating its potential therapeutic utility, the reason that p369–377 was not detected is unclear, but could be because the proteasome and immunoproteasome, which both frequently cleave at residues in the middle of this sequence, rapidly destroyed the epitope upon production. The observation, however, that products spanning the K-K bond in the substrate peptides accumulated among the reaction products, suggests that C-terminal processing does not occur. Our data do not rule out the possibility that p369–377 is generated in the cell by other mechanisms such as those involving serine and cysteine proteases, as well as aminopeptidases which trim the N-terminal amino acids of peptides in the cytosol and ER (31), all of which may act upon longer HER-2/neu sequences to yield the p369–377 epitope.
Unlike other epitopes, the processing of HER-2/neu p373–382 was not completely blocked in in vitro assays in the presence of the proteasome inhibitor, lactacystin. However, lactacystin only inhibits the trypsin, chymotrypsin, and caspase-like activities of the proteasome. The proteasome also has other lactacystin-resistant catalytic activities, including peptidyl-glutamyl peptide hydrolyzing (PGPH) and branched-chain amino acid preferring (BrAAP) activities, which could aid in processing of HER-2/neu p373–382 and account for some of the product detected in the presence of the inhibitor (29, 31–33).
When tested in stabilization assays, the affinity of p373–382 for binding to HLA-A2 molecules was comparable to that of the positive control peptide from influenza matrix protein, pFLU. The observation that p369–377 stabilized HLA-A2 is consistent with previous reports (34, 35). However, the EC50 for binding of p369–377 to HLA-A2 is significantly higher than that for both pFLU and p373–382, indicating that p373–382 has an increased binding affinity for HLA-A2 molecules. This stronger affinity for HLA-A2 may provide an explanation for the enhanced recognition of breast cancer cell lines by HER-2/neu p373–382 specific CTL; the p373–382 peptide may remain bound to the HLA-A2 molecules on cancer cells for a longer time, sustaining presentation to CTLs. This suggestion is consistent with prior studies showing a strong correlation between peptide:HLA complex stability and immunogenicity (36–39).
Evidence is provided for cross-reactivity of CTL lines generated by each of the two peptides which overlap in their sequences by 5 amino acids. HER-2/neu p373–382 specific CTLs recognized PBMC pulsed with p373–382 and to a slightly lesser extent, PBMC pulsed with p369–377. Vice versa, HER-2/neu p369–377 specific CTL recognized PBMC pulsed with p369–377 and PBMC pulsed with p373–382. There is a significant amount of data showing that T cells can be cross-reactive (40–45). One recent study elegantly showed that a single autoimmune TCR is able to recognize over a million different decamer peptides in the context of a single MHC class I molecule (45). In that study, several epitopes identified were much better agonists compared to the wildtype index peptide, despite sharing only a few common amino acids. Several mechanisms of cross-reactivity have been identified that could explain the cross-reactivity observed in the present study between p373–382 and p369–377 (46). Although the traditional view would be that these shared five amino acids would not occupy the same position in the closedbinding cleft in HLA class I molecules, recent data suggests fluidity and motion that may allow the different peptide:HLA complexes to assume (i.e. tune) similar 3-D structures that can be seen by the TCRs (42).
The binding of HER-2/neu p373–382 to HLA-A2 partially coincides with the identified anchor residues at positions 2 and 9 for nonamers (47). Leucine is a dominant amino acid residue that occupies position 2 of HLA-A2 motifs and it is present in the second position of p373–382 while absent from position 2 of p369–377. Valine and leucine are frequently found in position 9 of restricted nonomer epitopes. A leucine is found in position 9 of the p369–377 epitope, but neither leucine nor valine is found in position 9 of p373–382. Rather, p373–382 contains a terminal aspartic acid which is very rarely observed in the terminal position of an HLA-A2 epitope. Our search of the epitope database at the Immune Epitope Database and Analysis Resource (http://www.immuneepitope.org) reveals only ~6 HLA-A2 epitopes with terminal aspartic acid residues at the time of manuscript preparation. Arguably, much of the data that has been used to populate these and other databases has been based on prediction algorithms derived from a limited set of data obtained from elution studies or studies in which crystal structure of HLA class I peptide complexes have been solved (48). Despite that, however, it is clear from higher throughput studies that leucine and valine are favored at position 9 in nonomeric epitopes (48).
What has become more appreciated in recent times is that HLA-A2 can present longer epitopes from 10–15 amino acids. In a recent study, Scull and colleagues found that a large fraction of HLA-A2 peptides were longer than 9 amino acids (49). Furthermore, many of the longer peptides with the favored position 2 leucine anchor had a variety of different amino acids at putative anchor residue position 9, including charged amino acids such as threonine, lysine, and aspartic acid. Relevant to this study, several eluted longer peptides with a position 2 leucine also contained aspartic acids at position 10. In general, over the years, epitope identification has been an inherently biased approach focusing on characterizing nonamers. While it is likely that concepts derived from nonamers could in some ways extend to longer peptides, emerging data suggests critical differences exist. Myers and colleagues recently showed that HLA-A2 molecules on glioblastoma tumor cells express a novel 12 mer peptide frameshift (50). While a bona fide consensus HLA-A2 nonamer was fully contained within the 12 mer, molecular modeling revealed that binding of the nonamer to HLA-A2 was different at most of the amino acid positions. The similarities appeared to be largely confined to the terminal NH-2 moiety as well as the position 1 amino acid binding to the HLA molecule. Relevant to the current study, however, were the observations that the T cells generated against the 12 mer were cross-reactive with T cells generated against the embedded 9 mer, suggesting that there are areas shared by the 9 mer and 12 mer that are conserved enough for T cell recognition.
Predictive algorithms continue to improve and will likely shed additional light on longer peptides which may be relevant to vaccine-based therapeutic or prevention strategies. Several algorithms have now been developed that combine various factors that affect binding and which go beyond identifying motifs but rather contributions of all of the amino acids to binding. In more recent times, stabilized matrix method-based algorithms (e.g. SMMPMBEC and SMM) that address interactions between amino acids within an epitope rather than assuming independence have been developed which consistently outperform those algorithms than assume independence (e.g. SYFPEITHI) (25, 48, 51, 52). The stabilized matrix methods also outperform those based on neural networks (48, 51, 52). SMMPMBEC (51) and SMM (48) prediction methods show that p373–382 is predicted to bind with an IC50 of 2.7 µM and 0.482 µM, respectively. Our observation of an EC50 of 1.8 µM using the T2 stabilization assay is in good agreement with the predictions.
In closing, our investigations show that the commonly employed HLA-A2 binding HER-2/neu-derived peptide, p369–377, is not processed from HER-2/neu protein fragments by the proteasome or immunoproteasome as previously suggested. Rather, an overlapping 10 mer peptide, p373–382 was processed. Although p373–382 does not have a typical HLA-A2 binding amino acid sequence, binding studies demonstrate HLA-A2 binding activity. Furthermore, the peptide appears to be naturally processed and is able to elicit peptide-specific T cells that cross-react with p369–377-elicited T cells. The latter finding of cross-reactivity may explain the clinical utility of p369–377.
Quote:
MHC Class II Epitope Nesting Modulates Dendritic Cell Function and Improves Generation of Antigen-Specific CD4 Helper T Cells
Courtney L. Erskine, Christopher J. Krco, Karen E. Hedin, Nancy D. Borson, Kimberly R. Kalli, Marshall D. Behrens, Sabrina M. Heman-Ackah, Eric von Hofe, Peter J. Wettstein, Mansour Mohamadzadeh and Keith L. Knutson
J Immunol 2011; 187:316-324; Prepublished online 25 May 2011;
doi: 10.4049/jimmunol.1100658
www.jimmunol.org/content/187/1/316
Post 13649.
The HER2/neu vaccines that had been tested in the past either do not stimulate sufficient cytotoxic T-cell response on the Class I pathway or they do not give a long-lasting effect, resulting in short-lived peptide specific memory. TPIV 10 mer (p373-382) beat GALE 9 mere (369-377) in clinical efficacy. TPIV is expected to begin testing it’s HER2/neu vaccine in Phase II in 2016. It's a competition based market and TPIV covers more of it.
There are two requirements needed to create a good immune response:
1) Class 1 pathway: stimulate the cytotoxic lymphocyte, CD8 (killer T-cells) that will infiltrate and destroy tumor cells, and -- PRECLINICAL TESTING
2) Class 2 pathway: stimulate the pathway that stimulates the CD4 (T helper cells) for a prolonged immune response. -- TESTED in PHASE I -- TPIV-100
In 2016, HER2-neu which will combine the two licensed technology (Phase I TPIV-100 Class II antigen (4 epitopes) + the new Class I epitopes (p373–382) into a Phase II. Clinical testing show that the newest technology allows for epitopes spreading.
Quote:
TPIV-100 Class II antigen
Phase I Clinical Trials on HER2/neu Antigens to Start at Mayo Clinic
TapImmune Inc. (OTCBB: TPIV) has announced that following recent IRB approval a Phase I Clinical Trial on a novel set of HER2/neu Class II antigens will start at Mayo Clinic, Rochester MN. Mayo Clinic received IND allowance from the FDA for this trial in 2011. TapImmune is sponsoring the Phase I study and has an Exclusive Option to License the antigen technology at the end of Phase I. Following an overwhelming response from breast cancer patients wishing to be part of this trial, Mayo anticipates the initial patient recruitment to be fully subscribed. The study will have an interim safety analysis that will examine safety after 5 patients have been enrolled and received a single cycle of treatments.
These proprietary antigens were discovered by Keith Knutson Ph.D. and colleagues using a series of computer based predictions followed by testing of breast cancer patient responses to the predicted target peptides. Importantly this immune response data indicates that these antigens are naturally processed and that tolerance to these self-antigens is not a limiting factor. The peptides show high affinity binding to human MHC proteins for 84% of the population, making this potentially applicable to a wider spectrum of patients when compared to other HER-2/neu vaccine compositions. The next Phase trial will be carried out in breast cancer patients who finished standard Herceptin®- based therapy and are at a high risk of disease recurrence. The primary endpoints of the study will be safety and immunogenicity.
This study represents the first step in the clinical development of TapImmune’s HER-2/neu vaccine program, with follow on studies adding TAP expression and additional class I target peptides in a ‘prime and boost’ approach being the ultimate goal. It is, therefore, a major milestone for the Company.
Quote:
TPIV-110 Class I + Class II antigen
HER2/NEU CLINICAL TRIAL DETAILS:
Phase 1 Clinical Trial at Mayo Clinic Rochester MN
Trial Initiated June 28 2012 – Fully Enrolled & Ongoing
The current trial is on patients that have already had traditional therapies followed by a year of Herceptin.
22 breast cancer patients previously on Herceptin
Class II antigens (4 epitopes) discovered in breast cancer patients Clin. Cancer Res. (2010) 16, 825-83
6 x monthly intradermal vaccinations + GMCSF (adjuvant)
Phase I: Endpoints
Primary: Safety
Secondary: T-cell responses
Time to disease recurrence
Phase I: Analysis
Passed interim safety checkpoints
Interim analysis indicates specific T-cell responses in all patients analyzed
Data Supports Progression to Phase lb/ll
Clinical Trial Phase Ib/II (4+1) Strategy:
Class II antigens (4 epitopes [HER-neu.p59, p88, p422, p885]) from Phase l PLUS
Class I antigen (p373-382):
Superior Killer T Cell Epitope*
Naturally processed killer T-cell epitope (p373-382)
Log order increased binding to HLA-A2
Higher class I expression on human A2 cells
4-5x killing efficacy of human breast cancer cells
* Compared to E-75 (Neuvax). J. Immunol. (2013) 190, 479-488)
The desired clinical outcome of these trials will result in a vaccine conjugate that:
treats a significantly larger patient population
Up to 50% Vs 15-20% Herceptin
Is designed to KILL Tumor Cells. Herceptin does NOT.
Shows 4 to 5X Killing of Her2neu compared to Neuvax
Has combined Helpers and Killers for LONG LIVED KILLING
Quote:
Company Overview
Our Cancer Vaccines
TapImmune is a biotechnology company focusing on immunotherapy specializing in the development of innovative peptide and gene-based immunotherapeutics and vaccines for the treatment of cancer and infectious disease. The Company combines a set of proprietary technologies to improve the ability of the cellular immune system to destroy diseased cells. These are peptide antigen technologies and DNA expression technologies, PolystartTM and TAP.
To enhance shareholder value and taking into account development timelines, the Company plans to focus on advancing its clinical programs including our HER2/neu peptide antigen program and our Folate Receptor Alpha program for breast and ovarian trials into Phase II. In parallel, we plan to complete the preclinical development of our PolystartTM technology and to continue to develop the TAP-based franchise as an integral component of our prime-and-boost vaccine methodology.
The Immunotherapy Industry for Cancer
Immunotherapy has become the most rapidly growing sector in the pharmaceutical and biotech industry. The approval and success of checkpoint inhibitors Yervoy and Opdivo (Bristol Myers Squibb) and Keytruda (Merck) together with the development of CAR T-cell therapies (Juno, Kite) has provided much momentum in this sector. In addition, new evidence points to the increasing use of combination immunotherapies for the treatment of cancer. This has provided greater opportunities for the successful development of T-cell vaccines in combination with other approaches.
Products and Technology in Development
Clinical
Phase I Human Clinical Trials – HER2/neu+ Breast Cancer – Mayo Clinic
Patient dosing has been completed. Final safety analysis on all the patients treated is complete and shown to be safe. In addition, 19 out of 20 evaluable patients showed robust T-cell immune responses to the antigens in the vaccine composition providing a solid case for advancement to Phase II in 2015. An additional secondary endpoint incorporated into this Phase I Trial will be a two year follow on recording time to disease recurrence in the participating breast cancer patients.
For Phase I(b)/II studies, we plan to add a Class I peptide, licensed from the Mayo Clinic (April 16, 2012), to the four Class II peptides. Management believes that the combination of Class I and Class II HER2/neu antigens, gives us the leading HER2/neu vaccine platform. Therefore a key goal in 2015 is to progress the HER2/neu vaccine towards the above mentioned Phase 1(b)/II Clinical Trial.
Phase I Human Clinical Trials – Folate Alpha Breast and Ovarian Cancer – Mayo Clinic
Folate Receptor Alpha is expressed in over 80% of triple negative breast cancers, and in addition, over 90% of ovarian cancers, for which the only treatment options are surgery and chemotherapy, leaving a very important and urgent clinical need for a new therapeutic. Time to recurrence is relatively short for these types of cancer and survival prognosis is extremely poor after recurrence. In the United States alone, there are approximately 30,000 ovarian cancer patients and 40,000 triple negative breast cancer patients newly diagnosed every year.
A 24 patient Phase I clinical trial has been completed. The vaccine is well tolerated and safe and 20 out of 21 evaluable patients showed positive immune responses providing a strong rationale rational for progressing to phase 2 trials. GMP manufacturing for Phase II trials is underway and final analyses of clinical plans are near completion. TapImmune has now converted the exclusive license option into a full License Agreement.
Preclinical
PolystartTM
The Company has converted the previously filed U.S. Provisional Patent Application on PolystartTM into a full Patent Application, and will extend technology constructs as boost strategies for the current clinical programs in breast and ovarian cancer.
Current State of the Company
TapImmune is a clinical-stage immunotherapy company specializing in the development of innovative peptide and gene-based immunotherapeutics and vaccines for the treatment of cancer. The Company now has multiple clinical trials underway at the Mayo Clinic in Rochester, MN. In addition to our own sponsored clinical trials, a new grant-funded breast and ovarian cancer trial was started by Mayo using the same Folate Alpha Receptor peptides to which we have the exclusive commercial rights. Our development pipeline is extremely strong and provides us the opportunity to continue to expand on collaborations with leading institutions and corporations.
We continue to be focused on our entry into Phase II Triple Negative Cancer Trials including application for Fast Track & Orphan Drug Status as well as planning for Phase II HER2/neu Breast Cancer Trials.
We will also produce new PolyStartTM constructs, in-house, to facilitate collaborative efforts in our current clinical indications and those where others have already indicated interest in combination therapies.
In addition, we will continue to work on deficit reduction and capital improvement in order to make the required benchmarks for an uplisting to the NASDAQ or another major US exchange. To that end we are also anticipating the result of grant applications submitted early this year.
Together, these fundamental programs and corporate activities have positioned TapImmune extremely well to capitalize on the acceptance of immunotherapy as a leading therapeutic strategy in cancer and infectious disease resulting in exploding valuations in the market.
TapImmune’s Pipeline
The Company has a deep pipeline of potential blockbuster immunotherapies under development. Two of the clinical programs are completing Phase I studies and are expected to advance to Phase II in 2016. These are major inflection and valuation events, and we believe that, in light of these assets, the Company is significantly undervalued. Over the past year a number of highly visible transactions and billion dollar acquisitions have taken place that validate the work we are doing. We believe that, if our treatment successfully reaches commercialization, it will be applicable to 50% of the HER2/neu Breast Cancer market, which is a $21 billion annual market. Lastly, we further believe that if our Ovarian Cancer treatment reaches commercialization, it will be applicable to 95% of the market which Decision Resources, one of the world’s leading research firms for pharmaceuticals and healthcare, believes will triple in the next 10 years to at least $1.5 billion annually.
In addition to the exciting clinical developments, our peptide vaccine technology may be coupled with our recently developed in-house PolystartTM nucleic acid-based technology designed to make vaccines significantly more effective by producing four times the required peptides for the immune systems to recognize and act on. Our nucleic acid-based systems can also incorporate “TAP” which stands for Transporter associated with Antigen Presentation. Our technologies are also widely applicable to the treatment of emerging viral threats and pandemics. In particular, our highly versatile PolyStartTM technology has application in these areas. With respect to validation of our technologies, it is important to note that the majority of our technologies have been published in leading peer-reviewed journals. The timing of such publications is consistent with the filing of patents.
More specifics on the difference between p369-377 (GALE) and p373-382 (TPIV)
Quote:
J Immunol. 2013 Jan 1;190(1):479-88. doi: 10.4049/jimmunol.1201264. Epub 2012 Nov 23.
Enzymatic discovery of a HER-2/neu epitope that generates cross-reactive T cells.
Henle AM1, Erskine CL, Benson LM, Clynes R, Knutson KL.
Abstract
Patients with HER-2/neu-expressing breast cancer remain at risk for relapse following standard therapy. Vaccines targeting HER-2/neu to prevent relapse are in various phases of clinical testing. Many vaccines incorporate the HER-2/neu HLA-A2-binding peptide p369-377 (KIFGSLAFL), because it has been shown that CTLs specific for this epitope can directly kill HER-2/neu-overexpressing breast cancer cells. Thus, understanding how tumors process this epitope may be important for identifying those patients who would benefit from immunization. Proteasome preparations were used to determine if p369-377 was processed from larger HER-2/neu-derived fragments. HPLC, mass spectrometry, cytotoxicity assays, IFN-? ELISPOT, and human breast cancer cell lines were used to assess the proteolytic fragments. Processing of p369-377 was not detected by purified 20S proteasome and immunoproteasome, indicating that tumor cells may not be capable of processing this Ag from the HER-2/neu protein and presenting it in the context of HLA class I. Instead, we show that other extracellular domain HER-2/neu peptide sequences are consistently processed by the proteasomes. One of these sequences, p373-382 (SLAFLPESFD), bound HLA-A2 stronger than did p369-377. CTLs specific for p373-382 recognized both p373-382 and p369-377 complexed with HLA-A2. CTLs specific for p373-382 also killed human breast cancer cell lines at higher levels than did CTLs specific for p369-377. Conversely, CTLs specific for p369-377 recognized p373-382. Peptide p373-382 is a candidate epitope for breast cancer vaccines, as it is processed by proteasomes and binds HLA-A2.
Full article of part of TPIV new epitopes:
www.ncbi.nlm.nih.gov/pmc/articles/PMC3529812/
Enzymatic discovery of a HER-2/neu epitope that generates cross-reactive T cells
Andrea M. Henle,* Courtney L. Erskine,* Linda M. Benson,† Raphael Clynes,‡ and Keith L. Knutson*
Patients with HER-2/neu-expressing breast cancer remain at risk for relapse following standard therapy. Vaccines targeting HER-2/neu to prevent relapse are in various phases of clinical testing. Many vaccines incorporate the HER-2/neu HLA-A2 binding peptide p369–377 (KIFGSLAFL), since it has been shown that cytotoxic T lymphocytes (CTLs) specific for this epitope can directly kill HER-2/neu overexpressing breast cancer cells. Thus, understanding how tumors process this epitope may be important for identifying the patients that would benefit from immunization. Proteasome preparations were used to determine if p369–377 was processed from larger HER-2/neu derived fragments. HPLC, mass spectrometry, cytotoxicity assays, IFN-? ELIspot, and human breast cancer cell lines were used to assess the proteolytic fragments. Processing of p369–377 was not detected by purified 20S proteasome and immunoproteasome, indicating that tumor cells may not be capable of processing this antigen from the HER-2/neu protein and presenting it in the context of HLA class I. Instead, we show that other extracellular domain HER-2/neu peptide sequences are consistently processed by the proteasomes. One of these sequences, p373–382 (SLAFLPESFD), bound HLA-A2 stronger than p369–377. CTLs specific for p373–382 recognized both p373–382 and p369–377 complexed with HLA-A2. CTL specific for p373–382 also killed human breast cancer cell lines at higher levels than p369–377 specific CTL. Conversely, CTLs specific for p369–377 recognized p373–382. Peptide p373–382 is a candidate epitope for breast cancer vaccines as it is processed by proteasomes and binds HLA-A2.
Breast cancer is one of the leading causes of cancer death for women worldwide and is the leading site of cancer for females in the United States (1, 2). This year alone it is estimated that there will be approximately 226,870 new cases of invasive breast cancer and 39,510 deaths in females in the United States (1). Breast cancer is generally divided into three subtypes, estrogen receptor/progesterone receptor-positive, HER-2/neu receptor-positive, and triple negative breast cancers. Despite recent advances in therapy for primary breast tumors, relapse remains a significant concern, particularly for the HER-2/neu and triple negative subsets. Tumors that recur in these patients are often more aggressive, metastatic, chemoresistant and are the leading cause of death among women with breast cancer. Survival rates for patients with recurrent breast cancer are approximately 50% whereas the 5 year survival rate for patients with primary breast cancer is almost 90% (3).
INTRODUCTION:
Vaccines are being developed to prevent the recurrence of breast cancer. The majority of vaccines being tested in clinical trials are designed to augment the immune response against tumor antigens which are often overexpressed in breast tumors (4, 5). HER-2/neu, which is expressed in 20 to 40% of invasive breast tumors, is one antigen that is commonly targeted with vaccines (6). HER-2/neu is a transmembrane domain spanning receptor with an intracellular tyrosine kinase signaling domain. The HER2 signaling domain is activated upon heterodimerization with other members of the HER family (HER1, HER3, or HER4) or upon homo-dimerization (7, 8). Overexpression of this oncogenic protein leads to cellular transformation through increased proliferation and survival (7).
Although many different HER-2/neu vaccination strategies have been or are being investigated, vaccines formulated with synthetic cytotoxic T cell activating peptide epitopes are among the most advanced (9–13). For example, one vaccine strategy that has generated significant interest is composed of the adjuvant, GM-CSF, mixed with the HLA-A2 binding HER-2/neu extracellular domain derived peptide p369–377 (E75) (4, 5). Fisk and colleagues identified p369–377 in 1995 based on the presence of HLA-A2 anchoring motifs (14). Experiments using peptide-elicited CD8+ T cell clones or HLA-A2+ transgenic mice provided strong evidence of natural processing of p369–377 and HLA-A2 presentation (14, 15). Some controversy, however, emerged in 1998 when Zaks and Rosenberg failed to demonstrate that vaccine-elicited p369–377-specific T cells could readily recognize HLA-A2+ HER-2/neu+ tumors, casting some doubt on the utility of this epitope in eliciting therapeutic T cells (16). However, human studies by Knutson and colleagues further supported the prior studies suggesting natural presentation in HLA-A2 (17, 18).
Subsequent to this early work, Mittendorf and colleagues conducted exploratory Phase I and II clinical trials in early stage node-negative and node-positive breast cancer patients (5). In the most recent 24-month landmark analysis, Mittendorf reported summary results of those trials (4). Of 182 evaluable patients, 24-month disease free survival was 94.3% in the vaccine group and 86.8% in the control. Although not reaching statistical significance (p=0.08) when considering all evaluable patients, further analysis revealed statistically significant benefit in subsets of patients. Phase II and III clinical trials investigating p369–377 in combination with GM-CSF, with or without trastuzumab are ongoing (www.clinicaltrials.gov) to further determine clinical benefit.
Considering the potential for success of the p369–377 vaccine in preventing recurrence, our group became interested in developing biomarkers that may further enhance selection of patients that would benefit from the vaccine. Because p369–377 is displayed in the context of HLA class I, our interest in the present study focused on the role of the proteasome or immunoproteasome in processing p369–377. These proteasomes are two large multi-subunit complexes that are important for the processing of the vast majority of HLA class I presented epitopes (19). Once processed, the peptides released from the proteasomes are translocated into the endoplasmic reticulum via TAP1 and TAP2 and loaded onto class I molecules. Although p369–377 is an epitope that is empirically predicted to be processed by the proteasomes (Henle and Knutson, unpublished observation), to the best of our knowledge, no studies have specifically shown this biochemically, which was the focus of the present study. Thus, using purified human 20S proteasome and immunoproteasome, we asked whether p369–377 could be processed from longer HER-2/neu peptides, allowing it to be available for binding HLA class I molecules. Our data suggests that p369–377 is not processed by either the 20S proteasome or the immunoproteasome. However, other peptides derived from the extracellular domain of HER-2/neu were consistently processed by both enzymes. One newly identified peptide that is processed by both the immunoproteasome and proteasome is p373–382, a strong HLA-A2 binder that is able to prime CD8+ T cells for HER-2/neu+ breast tumor cell recognition and lysis.
MATERIALS AND METHODS
Cancer Cell Lines
The breast cancer cell lines SK-BR3, HCC1419, MCF7, and BT20 were purchased from the American Type Culture Collection (ATCC), immediately resuscitated and expanded in RPMI medium containing 10% FBS, and supplemented with 25 mM HEPES, 1.5 g/l sodium bicarbonate, 0.1 mM MEM nonessential amino acids, 1 mM sodium pyruvate, 2 mM l-glutamine, and 50 mM 2-ME (Invitrogen), at 37°C and 5% CO2. Prior to assays, the cell lines were incubated overnight with 500 U/ml IFN-? to ensure maximum HLA class I expression. The esophageal adenocarcinoma cell line, FLO-1, was a gift from Dr. Harry H. Yoon (Mayo Clinic, Rochester, MN). For verification, all tumor cell lines were tested for HLA-A status using a Biotest HLA-A SSP kit (Dreieich, Germany) and were tested for HER-2/neu status using RT-PCR (primer sequences: F: (GCTCTTTGAGGACAACTATGCCC) R: (GCCCTTACACATCGGAGAACAG)). Tumor cells were frozen as seeding stocks. For the assays, the cells were thawed rapidly in a 37°C water bath and expanded in RPMI medium as described above. Since HER-2/neu expression has been associated with loss of class I expression in some models (20, 21), the HLA-A2 and HER-2/neu status of each cell line were verified by flow cytometry following exposure to IFN-?, as we have previously described (22), using mouse anti-human HLA-A2 FITC and anti HER-2/neu FITC antibodies. Cognate isotypes were, respectively, mouse IgG2b,? FITC isotype and mouse IgG1,? FITC isotype (BD Pharmingen).
Peptide and Protein Synthesis
The peptides used in this study were the ovalbumin peptide (OVA), SIINFEKL; the HLA-A2 binding influenza matrix protein M1 peptide p58–66 (pFLU), GILGFVFTL; and the HER-2/neu peptides p369–377, KIFGSLAFL; p368–376, KKIFGSLAF; p372–380, GSLAFLPES; p364–373, FAGCKKIFGS; p373–382, SLAFLPESFD; p364–382, FAGCKKIFGSLAFLPESFD; and p362–384, QEFAGCKKIFGSLAFLPESFDGD. All peptides were manufactured by the Mayo Clinic Proteomics Core or Elim Biopharmaceuticals and were greater than 80% pure as assessed by HPLC and mass-spectrometric analysis. The HER-2/neu extracellular domain (ECD) was purified by trastuzumab affinity chromatography from culture supernatants of baby hamster kidney cell-produced extracellular domain as previously described by us and others (23, 24).
Prediction Algorithms
Potential HLA-A2 binding peptides from large HER-2/neu peptide sequences were predicted using a matrix pattern that calculates how peptides bind to the HLA-A2 motif based on previously published peptide motifs. The prediction algorithm is “SYFPEITHI: database for MHC ligands and peptide motifs” (25). It can be accessed via: www.syfpeithi.de.
The C-Term 3.0 and 20S prediction networks on the Netchop 3.1 Server (http://www.cbs.dtu.dk/services/NetChop/), and proteasome and immunoproteasome models 1, 2, and 3 on the Proteasome Cleavage Prediction Server (http://imed.med.ucm.es/Tools/pcps/index.html) were used to identify the cleavage of potential HLA-A2 binding peptides from large HER-2/neu peptide sequences. Results from all possible cleavage prediction methods were compiled for the study.
HLA-A2 Stabilization Assays
The lymphoblastic cell line, T2 (ATCC), was maintained at 37°C and 5% CO2 in Iscove's Modified Dulbecco's Medium (IMDM) supplemented with 20% FBS. For stabilization assessment, T2 cells were washed, counted, and resuspended at 1 × 106 cells/mL in IMDM in a 24-well plate and pulsed with a serial dilution of 0.2 – 100 µM peptide for 16 hours at room temperature. Subsequently, cells were washed 3× in PBS/0.5% BSA and stained with anti-HLA-A2 FITC antibody (clone BB7.2, BD Pharmingen) or isotype control mouse IgG2b,? FITC antibody (BD Pharmingen) and analyzed by flow cytometry on a FACScan with CellQuest software (BD Biosciences). Influenza peptide (pFLU, GILGFVFTL, (26)) served as a positive control. SIINFEKL served as the negative control peptide.
Human T Cell Isolation and Cultures
Whole blood samples obtained from Leuko Reduced Separator (LRS) Chambers (Trima) from the Department of Transfusion Medicine at Mayo Clinic were lysed in ammonium-chloride-potassium (ACK) buffer and separated over Ficoll-Paque (GE Healthcare). 1×106cells from the peripheral blood mononuclear cell (PBMC) fraction were stained with mouse anti-human HLA-A2 FITC BB7.2 antibody (BD Pharmingen) or mouse IgG2b,? FITC antibody (BD Pharmingen) and analyzed with a FACScan flow cytometer (BD Biosciences). PBMC samples which stained positive for HLA-A2 were further enriched with the CD8+ T Cell Isolation Kit II (Miltenyi Biotec) and separated by AutoMACS (Miltenyi Biotec) per the manufacturer's protocol.
Enriched CD8+ T cells were plated in 2 mL media in 6 well plates at 2×106 cells per mL. Peptide was added at a concentration of 10 µg/mL. Remaining CD8- PBMC were frozen for future restimulations. On days 3 and 5, human recombinant IL-2 was added to the wells at 50 U/mL and human recombinant IFN-? was added at 100 U/mL. On day 7, cryopreserved PBMC were thawed, washed three times, pulsed with 10 µg/mL peptide for 2 hours, and irradiated to 4000 rads. The PBMC were washed and suspended in fresh media and then added to the CD8+ T cells. One additional restimulation was done on day 14. The cells were used for assays on Days 21 through 28.
Human ELISpot
An IFN-? ELISpot (enzyme-linked immunosorbent spot) assay was performed as described previously (18). Briefly, cultured CD8+ T cells were incubated at 37°C for 48 hours with breast cancer cell lines or PBMC that had been pulsed with 100 µM peptide at 37°C and 5% CO2 for 16 hours, media alone, or PMA ionomycin. Respective wells containing target cells were, in some assays, incubated with blocking antibodies for 1 hour at a concentration of 1 µg per 100 µl RPMI + 10% FBS media prior to CD8+ T cell addition. All antibodies were from BD Pharmingen (purified mouse anti-human HLA-A2 BB7.2, purified mouse anti-human HLA-ABC W6/32, purified mouse IgG2b,? isotype control, and purified IgG2a,? isotype control).
Cytolytic T Cell Assays
Lysis of tumor cells was done using an impedance-based approach as previously described (22, 27). 100 µl of RPMI 1640 (Mediatech) with 10% FBS was added to each well in an E-Plate 16 (Roche). Background impedance on the plate was measured on the xCELLigence RTCA SP instrument (Roche) at 37°C and 5% CO2. Human tumor cell lines (SK-BR3, MCF7, BT20, FLO, and HCC1419) were harvested with trypsin, counted, washed, and resuspended in RPMI 1640 with 10% FBS and 500 U/ml human IFN-? (PeproTech) at 5 × 104 cells/ml. IFN-? was used to ensure maximal upregulation of HLA class I molecules. 100 µl of the tumor cells were added to each well of the E-Plate 16, which was then placed in the xCELLigence RTCA DP. Impedance was measured every 5 minutes for approximately 20 hours at 37°C and 5% CO2 (until the cells adhered to the gold electrodes on the bottom of each well and proliferated to approximately 1 × 104 cells/well). T cells were counted and resuspended at a concentration of 5 × 105 cells/ml in RPMI + 10% FBS media. One hundred µl of T cells or media alone were then added to the respective wells. The E-plate 16 was placed in the xCELLigence RTCA SP and impedance measurements were recorded every 5 minutes for greater than 10 additional hours at 37°C and 5% CO2. T cell mediated death of tumor cells was monitored in real time and was indicated by a decrease in cell index. Data was analyzed with RTCA Software 1.2 (Acea Biosciences). Results were normalized 1 to 2 hours after T cell addition. Cytolytic activity was calculated as the percentage of cytolysis 10 hours after the normalization time (=[CIno effector-CIeffector]/CIno effector × 100). For HLA-class I blocking, antibodies were added at a concentration of 1 µg per 100 µl RPMI + 10% FBS media.
Proteasome and Immunoproteasome Cleavage Assay, HPLC, and Mass Spectrometry
Purified human 20S proteasome, immunoproteasome, PA28 activator a subunit, and synthetic lactacystin were obtained from Boston Biochem. Proteasome and immunoproteasome enzymes were assayed for activity with the fluorescent Suc-LLVYAMC substrate (Boston Biochem) per the manufacturer's protocol. Cleavage assays were performed in 400 µl reaction buffer (25 mM HEPES, 0.5 mM EDTA, pH 7.6, Boston Biochem). PA28 activator (stock 20 µM) was added to the reaction buffer to a final concentration of 14.5 nM. Human proteasome or immunoproteasome enzymes (stock 2 µM) were added to the reaction buffer to a final concentration of 1.45 nM. 10 mM peptide substrate (HER-2/neu 19 mer or 23 mer) was diluted in the reaction mix 1:1000. Some samples had lactacystin added to the reaction to a final concentration of 10 µM to inhibit the proteasome activity. Blanks without proteasome or immunoproteasome were run in parallel. Samples were incubated in a 37°C water bath for 30–60 minutes. Preliminary studies suggested no difference in the cleavage products detected between 30 minutes and 1 hour (data not shown). Samples were then filtered using pre-washed YM-30 30,000 kDa MWCO microcon filters (Millipore) at 14,000g for 15 minutes. Filter retentates were collected by inverted centrifugation at 3,000g for 3 minutes.
Cleavage products (5 µl of the reaction mixture) from the HER-2/neu peptide incubations were separated and identified using an Agilent 1100 HPLC system interfaced to an Agilent MSD/TOF mass spectrometer. The products were resolved on an Agilent Zorbax 300SB-C18 column (1×150 mm; 3.5µ; 45°C) using mobile phases containing H2O, acetonitrile, isopropanol, and formic acid (Pump A: 98:1:1:0.1 and Pump B: 10:80:10:0.1 (v/v/v/v)). The separation gradient was 5–60%B over 23 min; 80%B for 5 min; with a 7 min equilibration at 5%B using a flow rate of 60 µL/min. Mass spectra were collected in positive mode using an Electrospray Ionization (ESI) interface over an m/z range of 300 to 2800. Other instrument parameters used were spray voltage-3500V; Fragmentor-175V; Skimmer-65V; RF Octopole-250V; gas temp-325°C; gas flow-5 L/min; and nebulizer gas-30 psi. Raw spectra were obtained and peaks transformed to molecular masses using Agilent MassHunter Qualitative Analysis with Bioconfirm software (version B.02.00). The observed masses were then compared to the theoretical masses of the known HER-2/neu peptide sequences and assigned a sequence.
Statistical Analysis
Statistical analyses were performed using GraphPad Prism 5. Data were analyzed using One-way ANOVA, Tukey's, Mann-Whitney or Student's t-tests as stated in legend, and the results were considered statistically significant if p<0.05.
The proteasome and immunoproteasome fragment synthetic HER-2/neu derived peptides into multiple shorter peptides
A 19 amino acid sequence (p364–382, FAGCKKIFGSLAFLPESF) derived from the extracellular domain of HER-2/neu was synthesized to study whether the proteasome and immunoproteasome could cleave the HLA-A2 HER-2/neu epitope, p369–377. Processing studies utilizing longer peptides are common in the cancer epitope discovery field and provide greater detection in vitro compared to cleavage assays using full length recombinant HER-2/neu protein (28–30). HER-2/neu p369–377 is embedded in the synthesized 19 mer, with an extra 5 amino acids on both the N- and C-termini.
Purified proteasome and immunoproteasome enzymes were individually incubated with the 19 mer substrate and PA28 activator. Cleaved products were analyzed via LC-MS (Fig. 1A). Several peptides between 8 to 10 amino acids in length, the appropriate length for binding to HLA class I molecules, were detected in the cleaved samples. However, p369–377 was not detected in any of the samples (Fig. 1B). These results suggest that p369–377 is not a reaction product of the proteasome or immunoproteasome.
Peptides generated in vitro by proteasomes are predicted to bind HLA-A2
Since peptides other than p369–377 were detected as degradation products, weuestioned whether any of these peptides may serve as potential candidates for HER-2/neu cancer immunotherapies. Thus, an HLA binding prediction server, SYFPEITHI, was used to predict the ability of these other peptides to bind HLA-A2 molecules (Table I). Several peptides scored higher than 10 suggesting that these epitopes may bind HLA-A2. For comparison, p369–377 had a score of 28, indicating that it is predicted to bind strongly to HLA-A2, a finding which is consistent with prior studies (5). Proteasome and immunoproteasome cleavage servers were also used to compare algorithm predictions to the in vitro results. The cleavage predictions from the algorithms did not always correspond with the in vitro biochemical data (Table I). Specifically, the algorithm predictions aligned with the in vitro cleavage data in 6 of 12 (50%) peptides (Table I).
Binding of HER-2/neu p373–382 to HLA-A2 molecules
Since the algorithms predicted that many of the degradation peptides may serve as targets which could be displayed in HLA class I on the surface of breast cancer cells, T2 HLA-A2 stabilization assays were performed. Influenza matrix protein M1 peptide was used as the positive control since it is known to bind HLA-A2 strongly and result in HLA-A2 stabilization on the surface of T2 cells. SIINFEKL was used as the negative control as it does not bind HLA-A2. Four peptides (p368–376, KKIFGSLAF; p372–380, GSLAFLPES; p364–373, FAGCKKIFGS; and p373–382, SLAFLPESFD) identified via the in vitroproteasome and immunoproteasome assays were synthesized and tested for their binding to HLA-A2. Only the p369–377 epitope and another epitope, p373–382, resulted in increased surface levels of HLA-A2, indicating that these peptides are able to bind A2 and stabilize the complex (Fig. 2A and data not shown (non-binding HER-2/neu peptides)). Titration studies with each peptide were conducted to compare the peptide affinity for HLA-A2. The p373–382 epitope bound HLA-A2 strongly, resulting in HLA-A2 stabilization at concentrations as low as 200 nM. In contrast, p369–377 did not begin to stabilize HLA-A2 until the peptide was at a concentration of ~6–7 µM (Fig. 2B). Pulsing with 50 µM of the p373–382 peptide consistently resulted in increased surface expression of the HLA-A2 molecule on T2 cells, at levels similar to the positive control pFLU peptide (Fig. 2C). The p369–377 epitope stabilized HLA-A2 at approximately 50% of the maximal stabilization seen with pFLU HLA-A2 upregulation. The concentration of peptide that induced half maximal stabilization of HLA-A2 was ~ 0.94 µM for pFLU, ~1.8 µM for p373–382, and ~9.6 µM for p369–377 (Fig. 2D).
Processing of p373–382 and other peptides from a 23 mer sequence of HER-2/neu
Although the p373–382 peptide was released from the 19 mer peptide by both the proteasome and immunoproteasome and can bind HLA-A2, the epitope was located on the C-terminal end of the 19 mer and therefore cleavage between two adjacent amino acids was not possible to measure. However, in both the proteasome and immunoproteasome samples in Fig. 1, the potential for processing of the 19 mer into the p373–382 decamer was detected by monitoring C-terminal end conversion from an amide to a free acid (not shown).
To determine if p373–382 could be internally processed, a 23 mer peptide (p362–384, QEFAGCKKIFGSLAFLPESFDGD) from HER-2/neu was synthesized. The in vitroproteasome and immunoproteasome assays were repeated with the 23 mer. Although proteolysis was generally less efficient with the longer peptide, LC-MS showed that several peptide epitopes were detected in these samples (Supplementary Fig. S1A and Supplementary Table SI). Again, the p369–377 epitope was not detected in the proteasome or the immunoproteasome samples (Supplementary Fig. S1B). Extracted ion chromatograms showed that the p373–382 decamer was processed in both the proteasome and to a lesser extent, the immunoproteasome samples (Fig. 3). Although lower levels of the decamer were detected in the lactacystin inhibited reactions compared to the uninhibited proteasome reaction, generation of p373–382 was still present, suggesting the proteasome uses both lactacystin-resistant and sensitive catalysis to liberate the peptide. Overall comparison shows that the peptide products generated by proteolysis from the 23 mer were similar to the products obtained with the 19 mer peptide (Figs. 3B and C).
Generation of HER-2/neu peptide-specific CD8+ T cells
Thus far, the results suggest that p373–382 can be processed by the proteasome and immunoproteasome and that it binds HLA-A2 strongly, suggesting potential clinical relevance. To address this, blood was obtained from human donors and short term CD8+ T cell lines were generated against pFLU, p369–377 and p373–382. IFN-? ELISpot analysis using autologous peptide-pulsed PBMC as targets demonstrated specificity of the lines (Fig. 4A). The pFLU T cell line only recognized pFLU and none of the other peptide-pulsed PBMC targets. The p369–377 pulsed PBMC were recognized by the p369–377 CD8+ T cells and, unexpectedly, also by the p373–382 T cells. Similarly, the p373–382 pulsed PBMC were recognized by the p373–382 specific CD8+ T cells but also by the p369–377 specific T cells. Thus, the results show that T cells responsive to p373–382 exist in the human T cell repertoire.
HER-2/neu p373–382 specific CTL recognize breast cancer cells and naturally processed antigen
To address whether p373–382-generated T cells recognize HER-2/neu-expressing breast cancer cells, a panel of HER-2/neu and HLA-A2-expressing breast cancer cell lines was used in an ELISpot assay with the three different T cell lines (Fig. 4B). Using IFN-? ELISpot, the activities of the lines were compared. Despite equivalency of the cell lines, in terms of numbers of specific cells, as assessed in the ELISpot using autologous targets, p373–382-generated T cells generally recognized the breast cancer cells at higher levels compared to the p369–377 specific T cells. BT20 cells served as the negative control cell line as they are HLA-A2 negative. These results indicate that cancer cells may be processing and presenting the p373–382 peptide at their surface in the context of HLA-A2. The CD8+ T cell lines were also tested for cytotoxicity. Similar to the IFN-? ELISpot results, the p373–382 T cells lysed the cancer cell lines at higher levels compared to the p369–377 T cells. The BT-20 (HLA-A2 negative) and FLO (HER-2/neu negative and HLA-A2 positive) cell lines served as negative controls (Fig. 4C).
To further demonstrate that p373–382 is a naturally processed epitope from HER-2/neu, we pulsed autologous PBMC with HER-2/neu p373–382, pFLU, HER-2/neu ECD, and ovalbumin protein and assayed for IFN-?+ ELIspot with HER-2/neu p373–382 specific CD8+ T cells and pFLU specific CD8+ T cells. CD8+ T cells specific for p373–382 had a strong response against p373–382 pulsed PBMC and against HER-2/neu ECD pulsed PBMC (Fig. 4D). The amount of nonspecific activity displayed by the T cells was minimal as control pFLU specific T cells had little recognition of targets pulsed with HER-2/neu peptide and ovalbumin, and similarly, p373–382 specific T cells recognized control ovalbumin and pFLU pulsed targets at low levels.
IFN-? and lytic responses of p373–382-generated T cells are HLA class I restricted
To address whether the IFN-? response of p373–382-generated T cells was HLA class I restricted, T cells lines were generated against all three peptides, pFLU, p369–377, and p373–382 followed by IFN-? ELISpot testing in the presence or absence of a blocking anti-HLA-class I heavy chain antibody. The pFLU T cells did not recognize p373–382-pulsed PBMC targets. As expected, both the p369–377 and p373–382-generated T cells recognized p373–382 pulsed PBMC with IFN-? release (Fig. 5A). The addition of anti-HLA class I heavy chain (Anti-HLA-ABC) antibody resulted in a significant 90% reduction in the numbers of cells responding with IFN-?. The same cell line was tested several days later replacing anti-HLA-ABC with specific anti-HLA-A2 blocking antibody. As shown in Fig. 5B, anti-HLA-A2 blocked IFN-? release to the same extent as anti-HLA-ABC, suggesting that HLA-A2 is the primary mediator of reactivity. Also shown in Figs. 5A and 5B, the number of p369–377 T cells releasing IFN-? in response to p373–382-pulsed targets decreased completely with the addition of anti-HLA-ABC and anti-HLA-A2 antibodies, further supporting cross-reactivity of the p369–377 and p373–382 T cell lines. Consistent with the ELISpot analysis, blocking of HLA class I on the surface of SKBR3 breast cancer cells nearly abolished lysis of the tumor cells by both p369–377 T cells and p373–382 T cells (Fig. 5C).
Discussion
HER-2/neu peptide p369–377 was one of the earliest tumor antigen derived cytotoxic T cell epitopes to have been identified (14). Based on the success of moving this epitope into human clinical use, we chose to determine whether this epitope is cleaved for HLA-class I presentation by the immunoproteasome or proteasome. Despite a positive prediction result with the proteasome and immunoproteasome cleavage servers, cleavage of the peptide was not detected in in vitro proteasome and immunoproteasome assays. In contrast, an HPLC co-migrating peptide, HER-2/neu p373–382, was consistently observed. This peptide was able to generate antigen-specific CD8+ CTL from the peripheral blood of HLA-A2+normal donors that effectively killed HER-2/neu-expressing tumor cells. HER-2/neu p369–377-specific CD8+ CTL were also generated from the peripheral blood of HLA-A2+normal donors using the p369–377 peptide, but these did not recognize HLA-A2+ breast cancer cells as strongly as p373–382-specific CTL. These results suggest that HER-2/neu positive cancer cells produce p373–382 via the proteasome and immunoproteasome. HER-2/neu p373–382 may be an effective candidate to induce HER-2/neu specific effector CD8+ T cell responses in vivo in patients.
HER-2/neu p369–377 was not detected in in vitro proteasome and immunoproteasome assays. Despite an abundance of prior work demonstrating its potential therapeutic utility, the reason that p369–377 was not detected is unclear, but could be because the proteasome and immunoproteasome, which both frequently cleave at residues in the middle of this sequence, rapidly destroyed the epitope upon production. The observation, however, that products spanning the K-K bond in the substrate peptides accumulated among the reaction products, suggests that C-terminal processing does not occur. Our data do not rule out the possibility that p369–377 is generated in the cell by other mechanisms such as those involving serine and cysteine proteases, as well as aminopeptidases which trim the N-terminal amino acids of peptides in the cytosol and ER (31), all of which may act upon longer HER-2/neu sequences to yield the p369–377 epitope.
Unlike other epitopes, the processing of HER-2/neu p373–382 was not completely blocked in in vitro assays in the presence of the proteasome inhibitor, lactacystin. However, lactacystin only inhibits the trypsin, chymotrypsin, and caspase-like activities of the proteasome. The proteasome also has other lactacystin-resistant catalytic activities, including peptidyl-glutamyl peptide hydrolyzing (PGPH) and branched-chain amino acid preferring (BrAAP) activities, which could aid in processing of HER-2/neu p373–382 and account for some of the product detected in the presence of the inhibitor (29, 31–33).
When tested in stabilization assays, the affinity of p373–382 for binding to HLA-A2 molecules was comparable to that of the positive control peptide from influenza matrix protein, pFLU. The observation that p369–377 stabilized HLA-A2 is consistent with previous reports (34, 35). However, the EC50 for binding of p369–377 to HLA-A2 is significantly higher than that for both pFLU and p373–382, indicating that p373–382 has an increased binding affinity for HLA-A2 molecules. This stronger affinity for HLA-A2 may provide an explanation for the enhanced recognition of breast cancer cell lines by HER-2/neu p373–382 specific CTL; the p373–382 peptide may remain bound to the HLA-A2 molecules on cancer cells for a longer time, sustaining presentation to CTLs. This suggestion is consistent with prior studies showing a strong correlation between peptide:HLA complex stability and immunogenicity (36–39).
Evidence is provided for cross-reactivity of CTL lines generated by each of the two peptides which overlap in their sequences by 5 amino acids. HER-2/neu p373–382 specific CTLs recognized PBMC pulsed with p373–382 and to a slightly lesser extent, PBMC pulsed with p369–377. Vice versa, HER-2/neu p369–377 specific CTL recognized PBMC pulsed with p369–377 and PBMC pulsed with p373–382. There is a significant amount of data showing that T cells can be cross-reactive (40–45). One recent study elegantly showed that a single autoimmune TCR is able to recognize over a million different decamer peptides in the context of a single MHC class I molecule (45). In that study, several epitopes identified were much better agonists compared to the wildtype index peptide, despite sharing only a few common amino acids. Several mechanisms of cross-reactivity have been identified that could explain the cross-reactivity observed in the present study between p373–382 and p369–377 (46). Although the traditional view would be that these shared five amino acids would not occupy the same position in the closedbinding cleft in HLA class I molecules, recent data suggests fluidity and motion that may allow the different peptide:HLA complexes to assume (i.e. tune) similar 3-D structures that can be seen by the TCRs (42).
The binding of HER-2/neu p373–382 to HLA-A2 partially coincides with the identified anchor residues at positions 2 and 9 for nonamers (47). Leucine is a dominant amino acid residue that occupies position 2 of HLA-A2 motifs and it is present in the second position of p373–382 while absent from position 2 of p369–377. Valine and leucine are frequently found in position 9 of restricted nonomer epitopes. A leucine is found in position 9 of the p369–377 epitope, but neither leucine nor valine is found in position 9 of p373–382. Rather, p373–382 contains a terminal aspartic acid which is very rarely observed in the terminal position of an HLA-A2 epitope. Our search of the epitope database at the Immune Epitope Database and Analysis Resource (http://www.immuneepitope.org) reveals only ~6 HLA-A2 epitopes with terminal aspartic acid residues at the time of manuscript preparation. Arguably, much of the data that has been used to populate these and other databases has been based on prediction algorithms derived from a limited set of data obtained from elution studies or studies in which crystal structure of HLA class I peptide complexes have been solved (48). Despite that, however, it is clear from higher throughput studies that leucine and valine are favored at position 9 in nonomeric epitopes (48).
What has become more appreciated in recent times is that HLA-A2 can present longer epitopes from 10–15 amino acids. In a recent study, Scull and colleagues found that a large fraction of HLA-A2 peptides were longer than 9 amino acids (49). Furthermore, many of the longer peptides with the favored position 2 leucine anchor had a variety of different amino acids at putative anchor residue position 9, including charged amino acids such as threonine, lysine, and aspartic acid. Relevant to this study, several eluted longer peptides with a position 2 leucine also contained aspartic acids at position 10. In general, over the years, epitope identification has been an inherently biased approach focusing on characterizing nonamers. While it is likely that concepts derived from nonamers could in some ways extend to longer peptides, emerging data suggests critical differences exist. Myers and colleagues recently showed that HLA-A2 molecules on glioblastoma tumor cells express a novel 12 mer peptide frameshift (50). While a bona fide consensus HLA-A2 nonamer was fully contained within the 12 mer, molecular modeling revealed that binding of the nonamer to HLA-A2 was different at most of the amino acid positions. The similarities appeared to be largely confined to the terminal NH-2 moiety as well as the position 1 amino acid binding to the HLA molecule. Relevant to the current study, however, were the observations that the T cells generated against the 12 mer were cross-reactive with T cells generated against the embedded 9 mer, suggesting that there are areas shared by the 9 mer and 12 mer that are conserved enough for T cell recognition.
Predictive algorithms continue to improve and will likely shed additional light on longer peptides which may be relevant to vaccine-based therapeutic or prevention strategies. Several algorithms have now been developed that combine various factors that affect binding and which go beyond identifying motifs but rather contributions of all of the amino acids to binding. In more recent times, stabilized matrix method-based algorithms (e.g. SMMPMBEC and SMM) that address interactions between amino acids within an epitope rather than assuming independence have been developed which consistently outperform those algorithms than assume independence (e.g. SYFPEITHI) (25, 48, 51, 52). The stabilized matrix methods also outperform those based on neural networks (48, 51, 52). SMMPMBEC (51) and SMM (48) prediction methods show that p373–382 is predicted to bind with an IC50 of 2.7 µM and 0.482 µM, respectively. Our observation of an EC50 of 1.8 µM using the T2 stabilization assay is in good agreement with the predictions.
In closing, our investigations show that the commonly employed HLA-A2 binding HER-2/neu-derived peptide, p369–377, is not processed from HER-2/neu protein fragments by the proteasome or immunoproteasome as previously suggested. Rather, an overlapping 10 mer peptide, p373–382 was processed. Although p373–382 does not have a typical HLA-A2 binding amino acid sequence, binding studies demonstrate HLA-A2 binding activity. Furthermore, the peptide appears to be naturally processed and is able to elicit peptide-specific T cells that cross-react with p369–377-elicited T cells. The latter finding of cross-reactivity may explain the clinical utility of p369–377.
Quote:
MHC Class II Epitope Nesting Modulates Dendritic Cell Function and Improves Generation of Antigen-Specific CD4 Helper T Cells
Courtney L. Erskine, Christopher J. Krco, Karen E. Hedin, Nancy D. Borson, Kimberly R. Kalli, Marshall D. Behrens, Sabrina M. Heman-Ackah, Eric von Hofe, Peter J. Wettstein, Mansour Mohamadzadeh and Keith L. Knutson
J Immunol 2011; 187:316-324; Prepublished online 25 May 2011;
doi: 10.4049/jimmunol.1100658
www.jimmunol.org/content/187/1/316
Recent MRKR News
- Principal Investigator from City of Hope National Medical Center Invited to Present Clinical Data from Marker Therapeutics APOLLO Study at 11th Global Summit on Hematologic Malignancies • GlobeNewswire Inc. • 04/08/2024 11:00:39 AM
- Marker Therapeutics Reports Year-End 2023 Corporate and Financial Results • GlobeNewswire Inc. • 03/25/2024 09:45:00 PM
- Marker Therapeutics to Present at the H.C. Wainwright 2nd Annual Cell Therapy Virtual Conference • GlobeNewswire Inc. • 03/22/2024 04:30:51 PM
- Form 8-K - Current report • Edgar (US Regulatory) • 03/01/2024 01:02:47 PM
- Form 8-K - Current report • Edgar (US Regulatory) • 02/26/2024 12:58:51 PM
- Marker Therapeutics Receives Approval from United States Adopted Name (USAN) Council and International Nonproprietary Names (INN) Expert Committee for “Neldaleucel” as Nonproprietary Name for MT-601 • GlobeNewswire Inc. • 01/22/2024 12:30:00 PM
- Form 8-K - Current report • Edgar (US Regulatory) • 01/08/2024 01:30:48 PM
- Marker Therapeutics Announces Clinical Program Updates and Pipeline Prioritization • GlobeNewswire Inc. • 01/08/2024 01:24:49 PM
- Marker Therapeutics Announces Participation in Biotech Showcase and the 19th Annual Non-Dilutive Funding Summit During “J.P. Morgan Week 2024” • GlobeNewswire Inc. • 12/21/2023 04:00:00 PM
- Form 8-K - Current report • Edgar (US Regulatory) • 12/11/2023 12:35:22 PM
- Marker Therapeutics Announces Sustained Complete Response in First Lymphoma Patient Treated with MT-601 following CAR T Relapse • GlobeNewswire Inc. • 12/11/2023 12:00:00 PM
- Form 8-K - Current report • Edgar (US Regulatory) • 11/20/2023 09:37:41 PM
- Form 8-K - Current report • Edgar (US Regulatory) • 11/09/2023 10:03:53 PM
- Marker Therapeutics Reports Third Quarter 2023 Financial Results and Provides Business Updates • GlobeNewswire Inc. • 11/09/2023 10:00:00 PM
- Form 10-Q - Quarterly report [Sections 13 or 15(d)] • Edgar (US Regulatory) • 11/09/2023 09:31:53 PM
- Form 8-K - Current report • Edgar (US Regulatory) • 09/11/2023 11:10:46 AM
- Marker Therapeutics Announces Complete Response in First Lymphoma Patient Treated with MT-601 after CAR T Relapse • GlobeNewswire Inc. • 09/11/2023 11:00:00 AM
- Marker Therapeutics to Present at the H.C. Wainwright 25th Annual Global Investment Conference • GlobeNewswire Inc. • 08/30/2023 12:00:38 PM
- Form 8-K - Current report • Edgar (US Regulatory) • 08/14/2023 08:37:04 PM
- Marker Therapeutics Reports Second Quarter 2023 Financial Results and Provides Business Update • GlobeNewswire Inc. • 08/14/2023 08:30:27 PM
- Form 10-Q - Quarterly report [Sections 13 or 15(d)] • Edgar (US Regulatory) • 08/14/2023 08:03:55 PM
- Form 8-K - Current report • Edgar (US Regulatory) • 08/07/2023 11:22:44 AM
- Marker Therapeutics Reports Non-Clinical Proof-of-Concept Data and Update on Clinical Readiness for the MT-401 Off-the-Shelf Program • GlobeNewswire Inc. • 08/07/2023 11:00:17 AM
- Marker Therapeutics to Participate in Virtual Roundtable with Key Opinion Leaders to Discuss Clinical Landscape of CAR-T Cell Therapies on August 9, 2023 • GlobeNewswire Inc. • 07/26/2023 11:00:00 AM
- Form 8-K - Current report • Edgar (US Regulatory) • 07/10/2023 11:09:50 AM
FEATURED Cannabix Technologies Launches New Compact Breath Logix Workplace Series and Prepares for Delivery to South Africa • May 7, 2024 8:51 AM
Moon Equity Holdings, Corp. Announces Acquisition of Wikolo, Inc. • MONI • May 7, 2024 9:48 AM
NanoViricides Reports that the Phase I NV-387 Clinical Trial is Completed Successfully and Data Lock is Expected Soon • NNVC • May 2, 2024 10:07 AM
ILUS Files Form 10-K and Provides Shareholder Update • ILUS • May 2, 2024 8:52 AM
Avant Technologies Names New CEO Following Acquisition of Healthcare Technology and Data Integration Firm • AVAI • May 2, 2024 8:00 AM
Bantec Engaged in a Letter of Intent to Acquire a Small New Jersey Based Manufacturing Company • BANT • May 1, 2024 10:00 AM
Start posting your company's news
Only $200 per official company press release!
